Incidental Mutation 'R5586:Retreg3'
ID 438742
Institutional Source Beutler Lab
Gene Symbol Retreg3
Ensembl Gene ENSMUSG00000017802
Gene Name reticulophagy regulator family member 3
Synonyms 4933404C01Rik, Fam134c, 1300010M03Rik
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 100987148-101010719 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 100997165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 105 (Q105P)
Ref Sequence ENSEMBL: ENSMUSP00000017946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017946] [ENSMUST00000107295]
AlphaFold Q9CQV4
Predicted Effect probably damaging
Transcript: ENSMUST00000017946
AA Change: Q105P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017946
Gene: ENSMUSG00000017802
AA Change: Q105P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
low complexity region 376 397 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107295
SMART Domains Protein: ENSMUSP00000102916
Gene: ENSMUSG00000017802

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 195 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154513
Meta Mutation Damage Score 0.1353 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,277,153 (GRCm39) noncoding transcript Het
Aaas A T 15: 102,255,111 (GRCm39) probably null Het
Abcc3 G A 11: 94,255,247 (GRCm39) R600W probably damaging Het
Abhd13 A T 8: 10,038,318 (GRCm39) Q305L probably benign Het
Adcy5 A T 16: 34,977,486 (GRCm39) I340F probably damaging Het
Adgrl3 T A 5: 81,871,994 (GRCm39) I964N probably damaging Het
Anks1b T A 10: 89,912,926 (GRCm39) H316Q probably damaging Het
Ap3d1 A T 10: 80,554,964 (GRCm39) F454I possibly damaging Het
Apol7c T C 15: 77,410,599 (GRCm39) R116G possibly damaging Het
Arhgap5 A G 12: 52,566,695 (GRCm39) E1222G possibly damaging Het
AW551984 A G 9: 39,502,559 (GRCm39) V673A probably benign Het
Baiap2l1 A G 5: 144,218,949 (GRCm39) S220P probably damaging Het
Bcl6 A G 16: 23,791,926 (GRCm39) F143L probably benign Het
Calb1 A T 4: 15,900,811 (GRCm39) T165S probably benign Het
Ccdc66 C A 14: 27,228,668 (GRCm39) G6C probably damaging Het
Ccdc88a A G 11: 29,453,484 (GRCm39) I344V probably benign Het
Cdh19 T A 1: 110,857,587 (GRCm39) D249V probably damaging Het
Ces1c T A 8: 93,854,227 (GRCm39) T103S probably benign Het
Cfap54 T A 10: 92,808,473 (GRCm39) K1401* probably null Het
Copa T A 1: 171,932,789 (GRCm39) N371K probably damaging Het
Cyp2b10 A T 7: 25,616,437 (GRCm39) Y348F probably damaging Het
Dennd5a T C 7: 109,504,928 (GRCm39) R861G possibly damaging Het
Dhx8 T C 11: 101,623,862 (GRCm39) probably benign Het
Dido1 C T 2: 180,301,445 (GRCm39) W2153* probably null Het
Dlgap1 T A 17: 71,125,156 (GRCm39) V969D probably damaging Het
Dvl3 A G 16: 20,336,039 (GRCm39) D32G probably damaging Het
Epdr1 T C 13: 19,778,718 (GRCm39) D24G probably benign Het
Etnk2 T A 1: 133,307,043 (GRCm39) probably null Het
Fhad1 C T 4: 141,632,442 (GRCm39) M1232I probably benign Het
Gcnt2 A C 13: 41,014,429 (GRCm39) E200A probably damaging Het
Gm5174 A G 10: 86,492,409 (GRCm39) noncoding transcript Het
Gm6408 T A 5: 146,421,267 (GRCm39) F299I possibly damaging Het
Gpr85 G T 6: 13,836,000 (GRCm39) Y301* probably null Het
Gucy2e G T 11: 69,117,082 (GRCm39) P780T probably damaging Het
Icam5 A T 9: 20,946,116 (GRCm39) N316I probably damaging Het
Ifit1bl1 C T 19: 34,571,677 (GRCm39) R260Q probably damaging Het
Il1r1 A C 1: 40,264,411 (GRCm39) probably benign Het
Kif3c A T 12: 3,439,656 (GRCm39) I86F probably benign Het
Klhdc2 A G 12: 69,354,467 (GRCm39) probably null Het
Mast2 A G 4: 116,292,760 (GRCm39) L9P probably damaging Het
Mcoln1 G T 8: 3,560,389 (GRCm39) C316F probably damaging Het
Mon1a A T 9: 107,775,894 (GRCm39) D4V probably damaging Het
Ms4a18 T A 19: 10,991,038 (GRCm39) M19L probably benign Het
Nbea T C 3: 55,539,392 (GRCm39) K2790E probably benign Het
Niban1 C T 1: 151,593,307 (GRCm39) T664I probably benign Het
Noc3l C T 19: 38,803,139 (GRCm39) E167K possibly damaging Het
Nol10 G A 12: 17,466,829 (GRCm39) E570K possibly damaging Het
Nr2e3 T C 9: 59,856,484 (GRCm39) R69G probably damaging Het
Obscn G A 11: 58,892,294 (GRCm39) R1358* probably null Het
Or14j4 A T 17: 37,921,145 (GRCm39) F166I probably damaging Het
Or2b7 C A 13: 21,739,266 (GRCm39) V309F probably damaging Het
Or52e8b A G 7: 104,673,428 (GRCm39) I253T probably damaging Het
Or5b117 A T 19: 13,431,746 (GRCm39) M45K probably benign Het
Pak2 A T 16: 31,860,337 (GRCm39) D175E probably benign Het
Pccb C T 9: 100,867,856 (GRCm39) V357I possibly damaging Het
Pcdhb4 C T 18: 37,442,034 (GRCm39) P448L probably damaging Het
Pcdhb9 A G 18: 37,534,167 (GRCm39) M54V probably benign Het
Ppp3cb A G 14: 20,570,758 (GRCm39) probably benign Het
Ppp4r1 A G 17: 66,131,563 (GRCm39) D452G probably benign Het
Pramel18 T A 4: 101,767,317 (GRCm39) F189I probably benign Het
Prmt3 T A 7: 49,476,499 (GRCm39) D369E probably damaging Het
Psmd12 T A 11: 107,377,301 (GRCm39) V120D probably benign Het
Ptprb T C 10: 116,189,732 (GRCm39) L1797P probably damaging Het
Ptprm A G 17: 67,227,191 (GRCm39) S653P probably damaging Het
Pxdn T A 12: 30,053,141 (GRCm39) V926D probably damaging Het
Sacs A T 14: 61,443,890 (GRCm39) R1979* probably null Het
Scn2a T A 2: 65,537,639 (GRCm39) L696* probably null Het
Sema3c A T 5: 17,916,422 (GRCm39) N465Y probably damaging Het
Slc25a32 A T 15: 38,963,308 (GRCm39) V171E possibly damaging Het
Slc30a7 C T 3: 115,783,700 (GRCm39) V158I probably benign Het
Slc44a5 G A 3: 153,975,802 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,685,045 (GRCm39) D140G probably damaging Het
Slc7a11 G A 3: 50,397,532 (GRCm39) S60L possibly damaging Het
Spryd3 A T 15: 102,040,372 (GRCm39) H59Q probably benign Het
Sqstm1 T C 11: 50,093,849 (GRCm39) D256G probably damaging Het
Sst A T 16: 23,708,487 (GRCm39) S115T probably damaging Het
Stimate A G 14: 30,592,776 (GRCm39) K166E probably damaging Het
Surf1 T C 2: 26,805,963 (GRCm39) probably benign Het
Synj1 A T 16: 90,806,865 (GRCm39) probably benign Het
Tet1 C A 10: 62,714,073 (GRCm39) C574F probably damaging Het
Thnsl1 T A 2: 21,217,201 (GRCm39) Y318* probably null Het
Tomm70a A G 16: 56,942,493 (GRCm39) E90G probably damaging Het
Treml4 A G 17: 48,571,927 (GRCm39) D110G probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl1 C T 18: 63,797,396 (GRCm39) G283D probably damaging Het
Uba6 T C 5: 86,282,906 (GRCm39) D559G probably damaging Het
Usp4 T C 9: 108,233,661 (GRCm39) V94A possibly damaging Het
Vmn2r25 A C 6: 123,802,255 (GRCm39) C549W probably damaging Het
Vmn2r59 G T 7: 41,695,105 (GRCm39) Q436K probably benign Het
Wdr70 A T 15: 7,913,769 (GRCm39) Y627N possibly damaging Het
Xpr1 T C 1: 155,188,609 (GRCm39) I344V probably benign Het
Zfp423 T A 8: 88,585,968 (GRCm39) Q61L possibly damaging Het
Other mutations in Retreg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Retreg3 APN 11 100,991,751 (GRCm39) nonsense probably null
IGL02547:Retreg3 APN 11 100,997,204 (GRCm39) nonsense probably null
IGL03160:Retreg3 APN 11 100,990,501 (GRCm39) missense probably benign 0.03
IGL03405:Retreg3 APN 11 100,991,795 (GRCm39) missense probably damaging 1.00
R0646:Retreg3 UTSW 11 100,989,455 (GRCm39) unclassified probably benign
R1625:Retreg3 UTSW 11 100,992,875 (GRCm39) start codon destroyed probably null
R2215:Retreg3 UTSW 11 101,010,459 (GRCm39) nonsense probably null
R4361:Retreg3 UTSW 11 100,994,713 (GRCm39) splice site probably null
R5791:Retreg3 UTSW 11 100,991,769 (GRCm39) missense probably damaging 0.99
R6026:Retreg3 UTSW 11 100,997,226 (GRCm39) missense probably damaging 0.99
R6179:Retreg3 UTSW 11 100,994,721 (GRCm39) start gained probably benign
R6209:Retreg3 UTSW 11 101,010,526 (GRCm39) missense probably benign 0.27
R6869:Retreg3 UTSW 11 101,010,644 (GRCm39) start gained probably benign
R7553:Retreg3 UTSW 11 100,997,216 (GRCm39) missense possibly damaging 0.86
R7615:Retreg3 UTSW 11 100,993,806 (GRCm39) missense probably damaging 1.00
R8809:Retreg3 UTSW 11 100,992,852 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCCTAAAGCAACTAATTCAGAC -3'
(R):5'- GAAAGGTTGGAAGGCTCTCC -3'

Sequencing Primer
(F):5'- TTCAGACTTCAAGGATTAGTCCCCAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2016-10-26