Incidental Mutation 'R5586:Dhx8'
ID438743
Institutional Source Beutler Lab
Gene Symbol Dhx8
Ensembl Gene ENSMUSG00000034931
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 8
SynonymsRNA helicase, Ddx8, mDEAH6
MMRRC Submission 043140-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R5586 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101732919-101767358 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 101733036 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]
Predicted Effect probably benign
Transcript: ENSMUST00000039152
SMART Domains Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 168 240 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
S1 287 360 3.52e-18 SMART
low complexity region 453 469 N/A INTRINSIC
coiled coil region 496 525 N/A INTRINSIC
DEXDc 587 771 7.26e-33 SMART
HELICc 815 919 7.45e-21 SMART
HA2 980 1070 1.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125409
Predicted Effect probably benign
Transcript: ENSMUST00000129741
SMART Domains Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 115 187 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
S1 234 307 3.52e-18 SMART
low complexity region 400 416 N/A INTRINSIC
coiled coil region 443 472 N/A INTRINSIC
DEXDc 534 718 7.26e-33 SMART
HELICc 762 866 7.45e-21 SMART
HA2 927 1017 1.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156842
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,577,728 noncoding transcript Het
Aaas A T 15: 102,346,676 probably null Het
Abcc3 G A 11: 94,364,421 R600W probably damaging Het
Abhd13 A T 8: 9,988,318 Q305L probably benign Het
Adcy5 A T 16: 35,157,116 I340F probably damaging Het
Adgrl3 T A 5: 81,724,147 I964N probably damaging Het
Anks1b T A 10: 90,077,064 H316Q probably damaging Het
Ap3d1 A T 10: 80,719,130 F454I possibly damaging Het
Apol7c T C 15: 77,526,399 R116G possibly damaging Het
Arhgap5 A G 12: 52,519,912 E1222G possibly damaging Het
AW551984 A G 9: 39,591,263 V673A probably benign Het
Baiap2l1 A G 5: 144,282,139 S220P probably damaging Het
Bcl6 A G 16: 23,973,176 F143L probably benign Het
Calb1 A T 4: 15,900,811 T165S probably benign Het
Ccdc66 C A 14: 27,506,711 G6C probably damaging Het
Ccdc88a A G 11: 29,503,484 I344V probably benign Het
Cdh19 T A 1: 110,929,857 D249V probably damaging Het
Ces1c T A 8: 93,127,599 T103S probably benign Het
Cfap54 T A 10: 92,972,611 K1401* probably null Het
Copa T A 1: 172,105,222 N371K probably damaging Het
Cyp2b10 A T 7: 25,917,012 Y348F probably damaging Het
Dennd5a T C 7: 109,905,721 R861G possibly damaging Het
Dido1 C T 2: 180,659,652 W2153* probably null Het
Dlgap1 T A 17: 70,818,161 V969D probably damaging Het
Dvl3 A G 16: 20,517,289 D32G probably damaging Het
Epdr1 T C 13: 19,594,548 D24G probably benign Het
Etnk2 T A 1: 133,379,305 probably null Het
Fam129a C T 1: 151,717,556 T664I probably benign Het
Fhad1 C T 4: 141,905,131 M1232I probably benign Het
Gcnt2 A C 13: 40,860,953 E200A probably damaging Het
Gm12800 T A 4: 101,910,120 F189I probably benign Het
Gm5174 A G 10: 86,656,545 noncoding transcript Het
Gm6408 T A 5: 146,484,457 F299I possibly damaging Het
Gpr85 G T 6: 13,836,001 Y301* probably null Het
Gucy2e G T 11: 69,226,256 P780T probably damaging Het
Icam5 A T 9: 21,034,820 N316I probably damaging Het
Ifit1bl1 C T 19: 34,594,277 R260Q probably damaging Het
Il1r1 A C 1: 40,225,251 probably benign Het
Kif3c A T 12: 3,389,656 I86F probably benign Het
Klhdc2 A G 12: 69,307,693 probably null Het
Mast2 A G 4: 116,435,563 L9P probably damaging Het
Mcoln1 G T 8: 3,510,389 C316F probably damaging Het
Mon1a A T 9: 107,898,695 D4V probably damaging Het
Ms4a18 T A 19: 11,013,674 M19L probably benign Het
Nbea T C 3: 55,631,971 K2790E probably benign Het
Noc3l C T 19: 38,814,695 E167K possibly damaging Het
Nol10 G A 12: 17,416,828 E570K possibly damaging Het
Nr2e3 T C 9: 59,949,201 R69G probably damaging Het
Obscn G A 11: 59,001,468 R1358* probably null Het
Olfr115 A T 17: 37,610,254 F166I probably damaging Het
Olfr1472 A T 19: 13,454,382 M45K probably benign Het
Olfr1535 C A 13: 21,555,096 V309F probably damaging Het
Olfr675 A G 7: 105,024,221 I253T probably damaging Het
Pak2 A T 16: 32,041,519 D175E probably benign Het
Pccb C T 9: 100,985,803 V357I possibly damaging Het
Pcdhb4 C T 18: 37,308,981 P448L probably damaging Het
Pcdhb9 A G 18: 37,401,114 M54V probably benign Het
Ppp3cb A G 14: 20,520,690 probably benign Het
Ppp4r1 A G 17: 65,824,568 D452G probably benign Het
Prmt3 T A 7: 49,826,751 D369E probably damaging Het
Psmd12 T A 11: 107,486,475 V120D probably benign Het
Ptprb T C 10: 116,353,827 L1797P probably damaging Het
Ptprm A G 17: 66,920,196 S653P probably damaging Het
Pxdn T A 12: 30,003,142 V926D probably damaging Het
Retreg3 T G 11: 101,106,339 Q105P probably damaging Het
Sacs A T 14: 61,206,441 R1979* probably null Het
Scn2a T A 2: 65,707,295 L696* probably null Het
Sema3c A T 5: 17,711,424 N465Y probably damaging Het
Slc25a32 A T 15: 39,099,913 V171E possibly damaging Het
Slc30a7 C T 3: 115,990,051 V158I probably benign Het
Slc44a5 G A 3: 154,270,165 probably benign Het
Slc4a8 A G 15: 100,787,164 D140G probably damaging Het
Slc7a11 G A 3: 50,443,083 S60L possibly damaging Het
Spryd3 A T 15: 102,131,937 H59Q probably benign Het
Sqstm1 T C 11: 50,203,022 D256G probably damaging Het
Sst A T 16: 23,889,737 S115T probably damaging Het
Surf1 T C 2: 26,915,951 probably benign Het
Synj1 A T 16: 91,009,977 probably benign Het
Tet1 C A 10: 62,878,294 C574F probably damaging Het
Thnsl1 T A 2: 21,212,390 Y318* probably null Het
Tmem110 A G 14: 30,870,819 K166E probably damaging Het
Tomm70a A G 16: 57,122,130 E90G probably damaging Het
Treml4 A G 17: 48,264,899 D110G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 C T 18: 63,664,325 G283D probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Usp4 T C 9: 108,356,462 V94A possibly damaging Het
Vmn2r25 A C 6: 123,825,296 C549W probably damaging Het
Vmn2r59 G T 7: 42,045,681 Q436K probably benign Het
Wdr70 A T 15: 7,884,288 Y627N possibly damaging Het
Xpr1 T C 1: 155,312,863 I344V probably benign Het
Zfp423 T A 8: 87,859,340 Q61L possibly damaging Het
Other mutations in Dhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Dhx8 APN 11 101739807 missense probably damaging 0.99
IGL01957:Dhx8 APN 11 101754826 missense possibly damaging 0.48
IGL02039:Dhx8 APN 11 101764027 critical splice donor site probably null
IGL02115:Dhx8 APN 11 101752388 missense probably damaging 1.00
IGL02161:Dhx8 APN 11 101757606 missense probably damaging 1.00
IGL02691:Dhx8 APN 11 101752004 splice site probably benign
IGL02697:Dhx8 APN 11 101754781 missense probably damaging 1.00
FR4304:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4342:Dhx8 UTSW 11 101738206 frame shift probably null
FR4449:Dhx8 UTSW 11 101738184 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738190 small deletion probably benign
FR4449:Dhx8 UTSW 11 101738194 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738206 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738207 small insertion probably benign
FR4589:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738179 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738182 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738189 small insertion probably benign
R0402:Dhx8 UTSW 11 101752397 missense probably damaging 1.00
R0525:Dhx8 UTSW 11 101763928 missense probably damaging 1.00
R0969:Dhx8 UTSW 11 101739700 splice site probably benign
R1497:Dhx8 UTSW 11 101735387 intron probably benign
R1576:Dhx8 UTSW 11 101752319 missense probably damaging 1.00
R1758:Dhx8 UTSW 11 101766738 missense probably damaging 1.00
R1773:Dhx8 UTSW 11 101752363 missense possibly damaging 0.87
R1941:Dhx8 UTSW 11 101752198 critical splice donor site probably null
R1954:Dhx8 UTSW 11 101753279 missense probably damaging 0.98
R2124:Dhx8 UTSW 11 101762245 missense probably damaging 0.99
R2128:Dhx8 UTSW 11 101738409 missense probably benign 0.06
R2148:Dhx8 UTSW 11 101738377 nonsense probably null
R2206:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R2207:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R4667:Dhx8 UTSW 11 101738161 missense unknown
R4678:Dhx8 UTSW 11 101739808 missense probably damaging 1.00
R4825:Dhx8 UTSW 11 101738170 nonsense probably null
R4943:Dhx8 UTSW 11 101737700 nonsense probably null
R5341:Dhx8 UTSW 11 101738190 small deletion probably benign
R5662:Dhx8 UTSW 11 101766758 missense possibly damaging 0.89
R5664:Dhx8 UTSW 11 101740751 missense probably damaging 1.00
R6082:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6085:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6415:Dhx8 UTSW 11 101737687 missense unknown
R6658:Dhx8 UTSW 11 101764922 missense probably damaging 1.00
R6841:Dhx8 UTSW 11 101764792 missense probably damaging 0.98
R6918:Dhx8 UTSW 11 101738421 nonsense probably null
R7011:Dhx8 UTSW 11 101741520 missense probably damaging 1.00
R7098:Dhx8 UTSW 11 101737768 critical splice donor site probably null
R7153:Dhx8 UTSW 11 101740175 splice site probably null
R7284:Dhx8 UTSW 11 101754822 missense probably damaging 1.00
R7604:Dhx8 UTSW 11 101764797 missense probably damaging 1.00
R8135:Dhx8 UTSW 11 101738264 missense unknown
R8137:Dhx8 UTSW 11 101763982 missense probably damaging 1.00
R8256:Dhx8 UTSW 11 101740762 missense possibly damaging 0.93
R8284:Dhx8 UTSW 11 101757629 missense probably damaging 1.00
R8289:Dhx8 UTSW 11 101740745 missense probably benign 0.01
Z1177:Dhx8 UTSW 11 101757660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGGCGGGTGGAGTCTTC -3'
(R):5'- CAAAAGCCATCGGGACCTTC -3'

Sequencing Primer
(F):5'- GAACAGCGTAACTCAGTGCGTC -3'
(R):5'- ATCGGGACCTTCCTCCAG -3'
Posted On2016-10-26