Mutagenetix > Incidental Mutation

Incidental Mutation 'R5586:Dhx8'

438743

Institutional Source

Beutler Lab

Gene Symbol

Dhx8

Ensembl Gene

ENSMUSG00000034931

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 8

Synonyms

RNA helicase, Ddx8, mDEAH6

MMRRC Submission

043140-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R5586 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101732919-101767358 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 101733036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]

AlphaFold

A2A4P0

Predicted Effect

probably benign
Transcript: ENSMUST00000039152

SMART Domains

Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931

Domain	Start	End	E-Value	Type
low complexity region	2	8	N/A	INTRINSIC
low complexity region	168	240	N/A	INTRINSIC
low complexity region	244	254	N/A	INTRINSIC
S1	287	360	3.52e-18	SMART
low complexity region	453	469	N/A	INTRINSIC
coiled coil region	496	525	N/A	INTRINSIC
DEXDc	587	771	7.26e-33	SMART
HELICc	815	919	7.45e-21	SMART
HA2	980	1070	1.34e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125409

Predicted Effect

probably benign
Transcript: ENSMUST00000129741

SMART Domains

Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931

Domain	Start	End	E-Value	Type
low complexity region	2	8	N/A	INTRINSIC
low complexity region	115	187	N/A	INTRINSIC
low complexity region	191	201	N/A	INTRINSIC
S1	234	307	3.52e-18	SMART
low complexity region	400	416	N/A	INTRINSIC
coiled coil region	443	472	N/A	INTRINSIC
DEXDc	534	718	7.26e-33	SMART
HELICc	762	866	7.45e-21	SMART
HA2	927	1017	1.34e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156842

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

98% (101/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,577,728		noncoding transcript	Het
Aaas	A	T	15: 102,346,676		probably null	Het
Abcc3	G	A	11: 94,364,421	R600W	probably damaging	Het
Abhd13	A	T	8: 9,988,318	Q305L	probably benign	Het
Adcy5	A	T	16: 35,157,116	I340F	probably damaging	Het
Adgrl3	T	A	5: 81,724,147	I964N	probably damaging	Het
Anks1b	T	A	10: 90,077,064	H316Q	probably damaging	Het
Ap3d1	A	T	10: 80,719,130	F454I	possibly damaging	Het
Apol7c	T	C	15: 77,526,399	R116G	possibly damaging	Het
Arhgap5	A	G	12: 52,519,912	E1222G	possibly damaging	Het
AW551984	A	G	9: 39,591,263	V673A	probably benign	Het
Baiap2l1	A	G	5: 144,282,139	S220P	probably damaging	Het
Bcl6	A	G	16: 23,973,176	F143L	probably benign	Het
Calb1	A	T	4: 15,900,811	T165S	probably benign	Het
Ccdc66	C	A	14: 27,506,711	G6C	probably damaging	Het
Ccdc88a	A	G	11: 29,503,484	I344V	probably benign	Het
Cdh19	T	A	1: 110,929,857	D249V	probably damaging	Het
Ces1c	T	A	8: 93,127,599	T103S	probably benign	Het
Cfap54	T	A	10: 92,972,611	K1401*	probably null	Het
Copa	T	A	1: 172,105,222	N371K	probably damaging	Het
Cyp2b10	A	T	7: 25,917,012	Y348F	probably damaging	Het
Dennd5a	T	C	7: 109,905,721	R861G	possibly damaging	Het
Dido1	C	T	2: 180,659,652	W2153*	probably null	Het
Dlgap1	T	A	17: 70,818,161	V969D	probably damaging	Het
Dvl3	A	G	16: 20,517,289	D32G	probably damaging	Het
Epdr1	T	C	13: 19,594,548	D24G	probably benign	Het
Etnk2	T	A	1: 133,379,305		probably null	Het
Fam129a	C	T	1: 151,717,556	T664I	probably benign	Het
Fhad1	C	T	4: 141,905,131	M1232I	probably benign	Het
Gcnt2	A	C	13: 40,860,953	E200A	probably damaging	Het
Gm12800	T	A	4: 101,910,120	F189I	probably benign	Het
Gm5174	A	G	10: 86,656,545		noncoding transcript	Het
Gm6408	T	A	5: 146,484,457	F299I	possibly damaging	Het
Gpr85	G	T	6: 13,836,001	Y301*	probably null	Het
Gucy2e	G	T	11: 69,226,256	P780T	probably damaging	Het
Icam5	A	T	9: 21,034,820	N316I	probably damaging	Het
Ifit1bl1	C	T	19: 34,594,277	R260Q	probably damaging	Het
Il1r1	A	C	1: 40,225,251		probably benign	Het
Kif3c	A	T	12: 3,389,656	I86F	probably benign	Het
Klhdc2	A	G	12: 69,307,693		probably null	Het
Mast2	A	G	4: 116,435,563	L9P	probably damaging	Het
Mcoln1	G	T	8: 3,510,389	C316F	probably damaging	Het
Mon1a	A	T	9: 107,898,695	D4V	probably damaging	Het
Ms4a18	T	A	19: 11,013,674	M19L	probably benign	Het
Nbea	T	C	3: 55,631,971	K2790E	probably benign	Het
Noc3l	C	T	19: 38,814,695	E167K	possibly damaging	Het
Nol10	G	A	12: 17,416,828	E570K	possibly damaging	Het
Nr2e3	T	C	9: 59,949,201	R69G	probably damaging	Het
Obscn	G	A	11: 59,001,468	R1358*	probably null	Het
Olfr115	A	T	17: 37,610,254	F166I	probably damaging	Het
Olfr1472	A	T	19: 13,454,382	M45K	probably benign	Het
Olfr1535	C	A	13: 21,555,096	V309F	probably damaging	Het
Olfr675	A	G	7: 105,024,221	I253T	probably damaging	Het
Pak2	A	T	16: 32,041,519	D175E	probably benign	Het
Pccb	C	T	9: 100,985,803	V357I	possibly damaging	Het
Pcdhb4	C	T	18: 37,308,981	P448L	probably damaging	Het
Pcdhb9	A	G	18: 37,401,114	M54V	probably benign	Het
Ppp3cb	A	G	14: 20,520,690		probably benign	Het
Ppp4r1	A	G	17: 65,824,568	D452G	probably benign	Het
Prmt3	T	A	7: 49,826,751	D369E	probably damaging	Het
Psmd12	T	A	11: 107,486,475	V120D	probably benign	Het
Ptprb	T	C	10: 116,353,827	L1797P	probably damaging	Het
Ptprm	A	G	17: 66,920,196	S653P	probably damaging	Het
Pxdn	T	A	12: 30,003,142	V926D	probably damaging	Het
Retreg3	T	G	11: 101,106,339	Q105P	probably damaging	Het
Sacs	A	T	14: 61,206,441	R1979*	probably null	Het
Scn2a	T	A	2: 65,707,295	L696*	probably null	Het
Sema3c	A	T	5: 17,711,424	N465Y	probably damaging	Het
Slc25a32	A	T	15: 39,099,913	V171E	possibly damaging	Het
Slc30a7	C	T	3: 115,990,051	V158I	probably benign	Het
Slc44a5	G	A	3: 154,270,165		probably benign	Het
Slc4a8	A	G	15: 100,787,164	D140G	probably damaging	Het
Slc7a11	G	A	3: 50,443,083	S60L	possibly damaging	Het
Spryd3	A	T	15: 102,131,937	H59Q	probably benign	Het
Sqstm1	T	C	11: 50,203,022	D256G	probably damaging	Het
Sst	A	T	16: 23,889,737	S115T	probably damaging	Het
Surf1	T	C	2: 26,915,951		probably benign	Het
Synj1	A	T	16: 91,009,977		probably benign	Het
Tet1	C	A	10: 62,878,294	C574F	probably damaging	Het
Thnsl1	T	A	2: 21,212,390	Y318*	probably null	Het
Tmem110	A	G	14: 30,870,819	K166E	probably damaging	Het
Tomm70a	A	G	16: 57,122,130	E90G	probably damaging	Het
Treml4	A	G	17: 48,264,899	D110G	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Txnl1	C	T	18: 63,664,325	G283D	probably damaging	Het
Uba6	T	C	5: 86,135,047	D559G	probably damaging	Het
Usp4	T	C	9: 108,356,462	V94A	possibly damaging	Het
Vmn2r25	A	C	6: 123,825,296	C549W	probably damaging	Het
Vmn2r59	G	T	7: 42,045,681	Q436K	probably benign	Het
Wdr70	A	T	15: 7,884,288	Y627N	possibly damaging	Het
Xpr1	T	C	1: 155,312,863	I344V	probably benign	Het
Zfp423	T	A	8: 87,859,340	Q61L	possibly damaging	Het

Other mutations in Dhx8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01922:Dhx8	APN	11	101739807	missense	probably damaging	0.99
IGL01957:Dhx8	APN	11	101754826	missense	possibly damaging	0.48
IGL02039:Dhx8	APN	11	101764027	critical splice donor site	probably null
IGL02115:Dhx8	APN	11	101752388	missense	probably damaging	1.00
IGL02161:Dhx8	APN	11	101757606	missense	probably damaging	1.00
IGL02691:Dhx8	APN	11	101752004	splice site	probably benign
IGL02697:Dhx8	APN	11	101754781	missense	probably damaging	1.00
FR4304:Dhx8	UTSW	11	101738188	small insertion	probably benign
FR4342:Dhx8	UTSW	11	101738206	frame shift	probably null
FR4449:Dhx8	UTSW	11	101738184	small insertion	probably benign
FR4449:Dhx8	UTSW	11	101738190	small deletion	probably benign
FR4449:Dhx8	UTSW	11	101738194	small insertion	probably benign
FR4449:Dhx8	UTSW	11	101738206	small insertion	probably benign
FR4449:Dhx8	UTSW	11	101738207	small insertion	probably benign
FR4589:Dhx8	UTSW	11	101738188	small insertion	probably benign
FR4737:Dhx8	UTSW	11	101738179	small insertion	probably benign
FR4737:Dhx8	UTSW	11	101738182	small insertion	probably benign
FR4737:Dhx8	UTSW	11	101738189	small insertion	probably benign
R0402:Dhx8	UTSW	11	101752397	missense	probably damaging	1.00
R0525:Dhx8	UTSW	11	101763928	missense	probably damaging	1.00
R0969:Dhx8	UTSW	11	101739700	splice site	probably benign
R1497:Dhx8	UTSW	11	101735387	intron	probably benign
R1576:Dhx8	UTSW	11	101752319	missense	probably damaging	1.00
R1758:Dhx8	UTSW	11	101766738	missense	probably damaging	1.00
R1773:Dhx8	UTSW	11	101752363	missense	possibly damaging	0.87
R1941:Dhx8	UTSW	11	101752198	critical splice donor site	probably null
R1954:Dhx8	UTSW	11	101753279	missense	probably damaging	0.98
R2124:Dhx8	UTSW	11	101762245	missense	probably damaging	0.99
R2128:Dhx8	UTSW	11	101738409	missense	probably benign	0.06
R2148:Dhx8	UTSW	11	101738377	nonsense	probably null
R2206:Dhx8	UTSW	11	101750971	missense	probably benign	0.03
R2207:Dhx8	UTSW	11	101750971	missense	probably benign	0.03
R4667:Dhx8	UTSW	11	101738161	missense	unknown
R4678:Dhx8	UTSW	11	101739808	missense	probably damaging	1.00
R4825:Dhx8	UTSW	11	101738170	nonsense	probably null
R4943:Dhx8	UTSW	11	101737700	nonsense	probably null
R5341:Dhx8	UTSW	11	101738190	small deletion	probably benign
R5662:Dhx8	UTSW	11	101766758	missense	possibly damaging	0.89
R5664:Dhx8	UTSW	11	101740751	missense	probably damaging	1.00
R6082:Dhx8	UTSW	11	101764313	missense	probably damaging	1.00
R6085:Dhx8	UTSW	11	101764313	missense	probably damaging	1.00
R6415:Dhx8	UTSW	11	101737687	missense	unknown
R6658:Dhx8	UTSW	11	101764922	missense	probably damaging	1.00
R6841:Dhx8	UTSW	11	101764792	missense	probably damaging	0.98
R6918:Dhx8	UTSW	11	101738421	nonsense	probably null
R7011:Dhx8	UTSW	11	101741520	missense	probably damaging	1.00
R7098:Dhx8	UTSW	11	101737768	critical splice donor site	probably null
R7153:Dhx8	UTSW	11	101740175	splice site	probably null
R7284:Dhx8	UTSW	11	101754822	missense	probably damaging	1.00
R7604:Dhx8	UTSW	11	101764797	missense	probably damaging	1.00
R8135:Dhx8	UTSW	11	101738264	missense	unknown
R8137:Dhx8	UTSW	11	101763982	missense	probably damaging	1.00
R8256:Dhx8	UTSW	11	101740762	missense	possibly damaging	0.93
R8284:Dhx8	UTSW	11	101757629	missense	probably damaging	1.00
R8289:Dhx8	UTSW	11	101740745	missense	probably benign	0.01
R8696:Dhx8	UTSW	11	101733132	missense	unknown
R9061:Dhx8	UTSW	11	101741580	missense	possibly damaging	0.61
R9076:Dhx8	UTSW	11	101738195	missense
R9443:Dhx8	UTSW	11	101764914	missense	probably damaging	1.00
R9492:Dhx8	UTSW	11	101763982	missense	possibly damaging	0.67
R9554:Dhx8	UTSW	11	101754788	nonsense	probably null
R9700:Dhx8	UTSW	11	101733189	critical splice donor site	probably null
R9780:Dhx8	UTSW	11	101741577	missense	possibly damaging	0.73
Z1177:Dhx8	UTSW	11	101757660	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAAGGCGGGTGGAGTCTTC -3'
(R):5'- CAAAAGCCATCGGGACCTTC -3'

Sequencing Primer
(F):5'- GAACAGCGTAACTCAGTGCGTC -3'
(R):5'- ATCGGGACCTTCCTCCAG -3'

Posted On

2016-10-26