Incidental Mutation 'R5586:Pxdn'
ID 438748
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Name peroxidasin
Synonyms 2310075M15Rik, VPO1
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.601) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 29987607-30067657 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30053141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 926 (V926D)
Ref Sequence ENSEMBL: ENSMUSP00000151320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
AlphaFold Q3UQ28
Predicted Effect probably damaging
Transcript: ENSMUST00000122328
AA Change: V1106D

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: V1106D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218620
Predicted Effect probably damaging
Transcript: ENSMUST00000220271
AA Change: V926D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,277,153 (GRCm39) noncoding transcript Het
Aaas A T 15: 102,255,111 (GRCm39) probably null Het
Abcc3 G A 11: 94,255,247 (GRCm39) R600W probably damaging Het
Abhd13 A T 8: 10,038,318 (GRCm39) Q305L probably benign Het
Adcy5 A T 16: 34,977,486 (GRCm39) I340F probably damaging Het
Adgrl3 T A 5: 81,871,994 (GRCm39) I964N probably damaging Het
Anks1b T A 10: 89,912,926 (GRCm39) H316Q probably damaging Het
Ap3d1 A T 10: 80,554,964 (GRCm39) F454I possibly damaging Het
Apol7c T C 15: 77,410,599 (GRCm39) R116G possibly damaging Het
Arhgap5 A G 12: 52,566,695 (GRCm39) E1222G possibly damaging Het
AW551984 A G 9: 39,502,559 (GRCm39) V673A probably benign Het
Baiap2l1 A G 5: 144,218,949 (GRCm39) S220P probably damaging Het
Bcl6 A G 16: 23,791,926 (GRCm39) F143L probably benign Het
Calb1 A T 4: 15,900,811 (GRCm39) T165S probably benign Het
Ccdc66 C A 14: 27,228,668 (GRCm39) G6C probably damaging Het
Ccdc88a A G 11: 29,453,484 (GRCm39) I344V probably benign Het
Cdh19 T A 1: 110,857,587 (GRCm39) D249V probably damaging Het
Ces1c T A 8: 93,854,227 (GRCm39) T103S probably benign Het
Cfap54 T A 10: 92,808,473 (GRCm39) K1401* probably null Het
Copa T A 1: 171,932,789 (GRCm39) N371K probably damaging Het
Cyp2b10 A T 7: 25,616,437 (GRCm39) Y348F probably damaging Het
Dennd5a T C 7: 109,504,928 (GRCm39) R861G possibly damaging Het
Dhx8 T C 11: 101,623,862 (GRCm39) probably benign Het
Dido1 C T 2: 180,301,445 (GRCm39) W2153* probably null Het
Dlgap1 T A 17: 71,125,156 (GRCm39) V969D probably damaging Het
Dvl3 A G 16: 20,336,039 (GRCm39) D32G probably damaging Het
Epdr1 T C 13: 19,778,718 (GRCm39) D24G probably benign Het
Etnk2 T A 1: 133,307,043 (GRCm39) probably null Het
Fhad1 C T 4: 141,632,442 (GRCm39) M1232I probably benign Het
Gcnt2 A C 13: 41,014,429 (GRCm39) E200A probably damaging Het
Gm5174 A G 10: 86,492,409 (GRCm39) noncoding transcript Het
Gm6408 T A 5: 146,421,267 (GRCm39) F299I possibly damaging Het
Gpr85 G T 6: 13,836,000 (GRCm39) Y301* probably null Het
Gucy2e G T 11: 69,117,082 (GRCm39) P780T probably damaging Het
Icam5 A T 9: 20,946,116 (GRCm39) N316I probably damaging Het
Ifit1bl1 C T 19: 34,571,677 (GRCm39) R260Q probably damaging Het
Il1r1 A C 1: 40,264,411 (GRCm39) probably benign Het
Kif3c A T 12: 3,439,656 (GRCm39) I86F probably benign Het
Klhdc2 A G 12: 69,354,467 (GRCm39) probably null Het
Mast2 A G 4: 116,292,760 (GRCm39) L9P probably damaging Het
Mcoln1 G T 8: 3,560,389 (GRCm39) C316F probably damaging Het
Mon1a A T 9: 107,775,894 (GRCm39) D4V probably damaging Het
Ms4a18 T A 19: 10,991,038 (GRCm39) M19L probably benign Het
Nbea T C 3: 55,539,392 (GRCm39) K2790E probably benign Het
Niban1 C T 1: 151,593,307 (GRCm39) T664I probably benign Het
Noc3l C T 19: 38,803,139 (GRCm39) E167K possibly damaging Het
Nol10 G A 12: 17,466,829 (GRCm39) E570K possibly damaging Het
Nr2e3 T C 9: 59,856,484 (GRCm39) R69G probably damaging Het
Obscn G A 11: 58,892,294 (GRCm39) R1358* probably null Het
Or14j4 A T 17: 37,921,145 (GRCm39) F166I probably damaging Het
Or2b7 C A 13: 21,739,266 (GRCm39) V309F probably damaging Het
Or52e8b A G 7: 104,673,428 (GRCm39) I253T probably damaging Het
Or5b117 A T 19: 13,431,746 (GRCm39) M45K probably benign Het
Pak2 A T 16: 31,860,337 (GRCm39) D175E probably benign Het
Pccb C T 9: 100,867,856 (GRCm39) V357I possibly damaging Het
Pcdhb4 C T 18: 37,442,034 (GRCm39) P448L probably damaging Het
Pcdhb9 A G 18: 37,534,167 (GRCm39) M54V probably benign Het
Ppp3cb A G 14: 20,570,758 (GRCm39) probably benign Het
Ppp4r1 A G 17: 66,131,563 (GRCm39) D452G probably benign Het
Pramel18 T A 4: 101,767,317 (GRCm39) F189I probably benign Het
Prmt3 T A 7: 49,476,499 (GRCm39) D369E probably damaging Het
Psmd12 T A 11: 107,377,301 (GRCm39) V120D probably benign Het
Ptprb T C 10: 116,189,732 (GRCm39) L1797P probably damaging Het
Ptprm A G 17: 67,227,191 (GRCm39) S653P probably damaging Het
Retreg3 T G 11: 100,997,165 (GRCm39) Q105P probably damaging Het
Sacs A T 14: 61,443,890 (GRCm39) R1979* probably null Het
Scn2a T A 2: 65,537,639 (GRCm39) L696* probably null Het
Sema3c A T 5: 17,916,422 (GRCm39) N465Y probably damaging Het
Slc25a32 A T 15: 38,963,308 (GRCm39) V171E possibly damaging Het
Slc30a7 C T 3: 115,783,700 (GRCm39) V158I probably benign Het
Slc44a5 G A 3: 153,975,802 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,685,045 (GRCm39) D140G probably damaging Het
Slc7a11 G A 3: 50,397,532 (GRCm39) S60L possibly damaging Het
Spryd3 A T 15: 102,040,372 (GRCm39) H59Q probably benign Het
Sqstm1 T C 11: 50,093,849 (GRCm39) D256G probably damaging Het
Sst A T 16: 23,708,487 (GRCm39) S115T probably damaging Het
Stimate A G 14: 30,592,776 (GRCm39) K166E probably damaging Het
Surf1 T C 2: 26,805,963 (GRCm39) probably benign Het
Synj1 A T 16: 90,806,865 (GRCm39) probably benign Het
Tet1 C A 10: 62,714,073 (GRCm39) C574F probably damaging Het
Thnsl1 T A 2: 21,217,201 (GRCm39) Y318* probably null Het
Tomm70a A G 16: 56,942,493 (GRCm39) E90G probably damaging Het
Treml4 A G 17: 48,571,927 (GRCm39) D110G probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl1 C T 18: 63,797,396 (GRCm39) G283D probably damaging Het
Uba6 T C 5: 86,282,906 (GRCm39) D559G probably damaging Het
Usp4 T C 9: 108,233,661 (GRCm39) V94A possibly damaging Het
Vmn2r25 A C 6: 123,802,255 (GRCm39) C549W probably damaging Het
Vmn2r59 G T 7: 41,695,105 (GRCm39) Q436K probably benign Het
Wdr70 A T 15: 7,913,769 (GRCm39) Y627N possibly damaging Het
Xpr1 T C 1: 155,188,609 (GRCm39) I344V probably benign Het
Zfp423 T A 8: 88,585,968 (GRCm39) Q61L possibly damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 30,037,098 (GRCm39) missense probably damaging 1.00
IGL01152:Pxdn APN 12 30,051,936 (GRCm39) missense probably damaging 0.99
IGL01286:Pxdn APN 12 30,032,753 (GRCm39) missense probably benign 0.04
IGL01323:Pxdn APN 12 30,037,136 (GRCm39) missense probably benign 0.00
IGL01338:Pxdn APN 12 30,052,796 (GRCm39) missense probably damaging 1.00
IGL01341:Pxdn APN 12 30,052,486 (GRCm39) missense probably damaging 1.00
IGL01401:Pxdn APN 12 30,051,983 (GRCm39) missense probably damaging 1.00
IGL01580:Pxdn APN 12 30,034,492 (GRCm39) missense probably benign 0.18
IGL01650:Pxdn APN 12 30,052,400 (GRCm39) missense probably benign 0.01
IGL01679:Pxdn APN 12 30,049,901 (GRCm39) missense probably damaging 0.97
IGL01866:Pxdn APN 12 30,034,570 (GRCm39) missense probably benign 0.02
IGL02354:Pxdn APN 12 30,049,188 (GRCm39) missense probably damaging 1.00
IGL02361:Pxdn APN 12 30,049,188 (GRCm39) missense probably damaging 1.00
IGL02427:Pxdn APN 12 30,034,531 (GRCm39) missense probably damaging 1.00
IGL02955:Pxdn APN 12 30,053,156 (GRCm39) missense probably damaging 1.00
IGL03079:Pxdn APN 12 30,052,997 (GRCm39) missense probably damaging 0.97
IGL03111:Pxdn APN 12 30,032,755 (GRCm39) missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30,053,113 (GRCm39) nonsense probably null
PIT4280001:Pxdn UTSW 12 30,045,327 (GRCm39) missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30,055,828 (GRCm39) missense probably benign 0.00
R0070:Pxdn UTSW 12 30,032,726 (GRCm39) missense probably damaging 0.99
R0070:Pxdn UTSW 12 30,032,726 (GRCm39) missense probably damaging 0.99
R0086:Pxdn UTSW 12 30,052,418 (GRCm39) missense possibly damaging 0.95
R0140:Pxdn UTSW 12 30,032,753 (GRCm39) missense probably benign 0.04
R0201:Pxdn UTSW 12 30,052,430 (GRCm39) missense possibly damaging 0.79
R0282:Pxdn UTSW 12 30,034,439 (GRCm39) nonsense probably null
R0310:Pxdn UTSW 12 30,065,528 (GRCm39) missense probably damaging 1.00
R0426:Pxdn UTSW 12 30,037,065 (GRCm39) missense possibly damaging 0.89
R0468:Pxdn UTSW 12 30,044,485 (GRCm39) missense probably damaging 0.99
R0825:Pxdn UTSW 12 30,034,995 (GRCm39) splice site probably benign
R0885:Pxdn UTSW 12 30,053,401 (GRCm39) missense probably benign 0.30
R1420:Pxdn UTSW 12 30,052,067 (GRCm39) missense probably damaging 1.00
R1588:Pxdn UTSW 12 30,052,558 (GRCm39) missense probably damaging 1.00
R2269:Pxdn UTSW 12 30,055,774 (GRCm39) missense probably damaging 0.97
R2280:Pxdn UTSW 12 30,034,905 (GRCm39) missense probably damaging 0.98
R2504:Pxdn UTSW 12 30,053,405 (GRCm39) missense probably damaging 1.00
R2679:Pxdn UTSW 12 30,025,568 (GRCm39) splice site probably benign
R3116:Pxdn UTSW 12 30,052,306 (GRCm39) missense possibly damaging 0.89
R3607:Pxdn UTSW 12 30,040,917 (GRCm39) missense probably benign 0.04
R4033:Pxdn UTSW 12 30,053,224 (GRCm39) missense probably benign 0.19
R4576:Pxdn UTSW 12 30,061,922 (GRCm39) missense probably benign
R4659:Pxdn UTSW 12 30,044,552 (GRCm39) missense probably benign 0.01
R4681:Pxdn UTSW 12 30,062,325 (GRCm39) missense probably benign 0.45
R4968:Pxdn UTSW 12 30,050,011 (GRCm39) missense probably benign 0.25
R5032:Pxdn UTSW 12 30,053,140 (GRCm39) missense probably benign 0.08
R5232:Pxdn UTSW 12 30,040,987 (GRCm39) missense probably benign 0.08
R5366:Pxdn UTSW 12 30,052,899 (GRCm39) missense probably damaging 1.00
R5504:Pxdn UTSW 12 30,052,800 (GRCm39) missense probably damaging 1.00
R5739:Pxdn UTSW 12 30,032,333 (GRCm39) missense probably benign 0.03
R5877:Pxdn UTSW 12 30,053,045 (GRCm39) missense probably damaging 1.00
R6167:Pxdn UTSW 12 30,024,000 (GRCm39) missense probably damaging 1.00
R6191:Pxdn UTSW 12 30,032,716 (GRCm39) missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30,053,111 (GRCm39) missense probably damaging 1.00
R6609:Pxdn UTSW 12 30,052,940 (GRCm39) missense probably benign 0.00
R6628:Pxdn UTSW 12 30,049,917 (GRCm39) missense probably damaging 1.00
R6865:Pxdn UTSW 12 30,064,582 (GRCm39) splice site probably null
R6921:Pxdn UTSW 12 30,065,504 (GRCm39) missense probably damaging 0.96
R6995:Pxdn UTSW 12 30,045,370 (GRCm39) missense possibly damaging 0.95
R7211:Pxdn UTSW 12 30,034,903 (GRCm39) missense possibly damaging 0.77
R7220:Pxdn UTSW 12 30,044,479 (GRCm39) missense probably benign 0.02
R7347:Pxdn UTSW 12 30,062,260 (GRCm39) missense probably benign 0.01
R7402:Pxdn UTSW 12 30,052,438 (GRCm39) missense probably damaging 1.00
R7408:Pxdn UTSW 12 30,040,944 (GRCm39) missense probably benign 0.29
R7413:Pxdn UTSW 12 30,052,927 (GRCm39) missense probably benign 0.00
R7447:Pxdn UTSW 12 30,034,926 (GRCm39) missense probably damaging 1.00
R7572:Pxdn UTSW 12 30,056,704 (GRCm39) missense probably damaging 1.00
R7708:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R7815:Pxdn UTSW 12 30,055,824 (GRCm39) missense probably damaging 0.96
R7972:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R8097:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R8098:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R8205:Pxdn UTSW 12 30,056,566 (GRCm39) missense probably damaging 1.00
R8262:Pxdn UTSW 12 30,049,195 (GRCm39) nonsense probably null
R8335:Pxdn UTSW 12 30,052,096 (GRCm39) missense probably damaging 0.99
R8356:Pxdn UTSW 12 30,061,889 (GRCm39) missense probably damaging 0.99
R8437:Pxdn UTSW 12 30,052,043 (GRCm39) missense probably damaging 1.00
R8456:Pxdn UTSW 12 30,061,889 (GRCm39) missense probably damaging 0.99
R8709:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R8772:Pxdn UTSW 12 30,065,463 (GRCm39) missense probably damaging 1.00
R8903:Pxdn UTSW 12 30,040,992 (GRCm39) missense probably benign
R9310:Pxdn UTSW 12 30,052,051 (GRCm39) missense probably damaging 1.00
R9487:Pxdn UTSW 12 30,044,552 (GRCm39) missense possibly damaging 0.90
Z1177:Pxdn UTSW 12 30,040,851 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGACCCCAGTGTCAATGC -3'
(R):5'- CAGGTCCTCAAAGGTGTAAGCAG -3'

Sequencing Primer
(F):5'- CCAGTGTCAATGCTGGCATC -3'
(R):5'- CCGACAAGTTGCAGTAGACTCTG -3'
Posted On 2016-10-26