Mutagenetix > Incidental Mutation

Incidental Mutation 'R5586:Arhgap5'

438749

Institutional Source

Beutler Lab

Gene Symbol

Arhgap5

Ensembl Gene

ENSMUSG00000035133

Gene Name

Rho GTPase activating protein 5

Synonyms

p190B, p190-B

MMRRC Submission

043140-MU

Accession Numbers

Genbank: NM_009706; MGI: 1332637

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5586 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52503972-52571975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52519912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1222 (E1222G)

Ref Sequence

ENSEMBL: ENSMUSP00000151809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110725
AA Change: E1222G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: E1222G

Domain	Start	End	E-Value	Type
Pfam:Ras	142	248	5.3e-7	PFAM
FF	269	325	6.03e-12	SMART
FF	367	420	4.61e-8	SMART
FF	427	482	2.22e-10	SMART
FF	483	537	3.89e-6	SMART
low complexity region	1035	1053	N/A	INTRINSIC
low complexity region	1224	1247	N/A	INTRINSIC
RhoGAP	1273	1447	1.03e-73	SMART
low complexity region	1479	1496	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217820

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218869

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219443
AA Change: E1222G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.1473

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

98% (101/103)

MGI Phenotype

Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,577,728		noncoding transcript	Het
Aaas	A	T	15: 102,346,676		probably null	Het
Abcc3	G	A	11: 94,364,421	R600W	probably damaging	Het
Abhd13	A	T	8: 9,988,318	Q305L	probably benign	Het
Adcy5	A	T	16: 35,157,116	I340F	probably damaging	Het
Adgrl3	T	A	5: 81,724,147	I964N	probably damaging	Het
Anks1b	T	A	10: 90,077,064	H316Q	probably damaging	Het
Ap3d1	A	T	10: 80,719,130	F454I	possibly damaging	Het
Apol7c	T	C	15: 77,526,399	R116G	possibly damaging	Het
AW551984	A	G	9: 39,591,263	V673A	probably benign	Het
Baiap2l1	A	G	5: 144,282,139	S220P	probably damaging	Het
Bcl6	A	G	16: 23,973,176	F143L	probably benign	Het
Calb1	A	T	4: 15,900,811	T165S	probably benign	Het
Ccdc66	C	A	14: 27,506,711	G6C	probably damaging	Het
Ccdc88a	A	G	11: 29,503,484	I344V	probably benign	Het
Cdh19	T	A	1: 110,929,857	D249V	probably damaging	Het
Ces1c	T	A	8: 93,127,599	T103S	probably benign	Het
Cfap54	T	A	10: 92,972,611	K1401*	probably null	Het
Copa	T	A	1: 172,105,222	N371K	probably damaging	Het
Cyp2b10	A	T	7: 25,917,012	Y348F	probably damaging	Het
Dennd5a	T	C	7: 109,905,721	R861G	possibly damaging	Het
Dhx8	T	C	11: 101,733,036		probably benign	Het
Dido1	C	T	2: 180,659,652	W2153*	probably null	Het
Dlgap1	T	A	17: 70,818,161	V969D	probably damaging	Het
Dvl3	A	G	16: 20,517,289	D32G	probably damaging	Het
Epdr1	T	C	13: 19,594,548	D24G	probably benign	Het
Etnk2	T	A	1: 133,379,305		probably null	Het
Fam129a	C	T	1: 151,717,556	T664I	probably benign	Het
Fhad1	C	T	4: 141,905,131	M1232I	probably benign	Het
Gcnt2	A	C	13: 40,860,953	E200A	probably damaging	Het
Gm12800	T	A	4: 101,910,120	F189I	probably benign	Het
Gm5174	A	G	10: 86,656,545		noncoding transcript	Het
Gm6408	T	A	5: 146,484,457	F299I	possibly damaging	Het
Gpr85	G	T	6: 13,836,001	Y301*	probably null	Het
Gucy2e	G	T	11: 69,226,256	P780T	probably damaging	Het
Icam5	A	T	9: 21,034,820	N316I	probably damaging	Het
Ifit1bl1	C	T	19: 34,594,277	R260Q	probably damaging	Het
Il1r1	A	C	1: 40,225,251		probably benign	Het
Kif3c	A	T	12: 3,389,656	I86F	probably benign	Het
Klhdc2	A	G	12: 69,307,693		probably null	Het
Mast2	A	G	4: 116,435,563	L9P	probably damaging	Het
Mcoln1	G	T	8: 3,510,389	C316F	probably damaging	Het
Mon1a	A	T	9: 107,898,695	D4V	probably damaging	Het
Ms4a18	T	A	19: 11,013,674	M19L	probably benign	Het
Nbea	T	C	3: 55,631,971	K2790E	probably benign	Het
Noc3l	C	T	19: 38,814,695	E167K	possibly damaging	Het
Nol10	G	A	12: 17,416,828	E570K	possibly damaging	Het
Nr2e3	T	C	9: 59,949,201	R69G	probably damaging	Het
Obscn	G	A	11: 59,001,468	R1358*	probably null	Het
Olfr115	A	T	17: 37,610,254	F166I	probably damaging	Het
Olfr1472	A	T	19: 13,454,382	M45K	probably benign	Het
Olfr1535	C	A	13: 21,555,096	V309F	probably damaging	Het
Olfr675	A	G	7: 105,024,221	I253T	probably damaging	Het
Pak2	A	T	16: 32,041,519	D175E	probably benign	Het
Pccb	C	T	9: 100,985,803	V357I	possibly damaging	Het
Pcdhb4	C	T	18: 37,308,981	P448L	probably damaging	Het
Pcdhb9	A	G	18: 37,401,114	M54V	probably benign	Het
Ppp3cb	A	G	14: 20,520,690		probably benign	Het
Ppp4r1	A	G	17: 65,824,568	D452G	probably benign	Het
Prmt3	T	A	7: 49,826,751	D369E	probably damaging	Het
Psmd12	T	A	11: 107,486,475	V120D	probably benign	Het
Ptprb	T	C	10: 116,353,827	L1797P	probably damaging	Het
Ptprm	A	G	17: 66,920,196	S653P	probably damaging	Het
Pxdn	T	A	12: 30,003,142	V926D	probably damaging	Het
Retreg3	T	G	11: 101,106,339	Q105P	probably damaging	Het
Sacs	A	T	14: 61,206,441	R1979*	probably null	Het
Scn2a	T	A	2: 65,707,295	L696*	probably null	Het
Sema3c	A	T	5: 17,711,424	N465Y	probably damaging	Het
Slc25a32	A	T	15: 39,099,913	V171E	possibly damaging	Het
Slc30a7	C	T	3: 115,990,051	V158I	probably benign	Het
Slc44a5	G	A	3: 154,270,165		probably benign	Het
Slc4a8	A	G	15: 100,787,164	D140G	probably damaging	Het
Slc7a11	G	A	3: 50,443,083	S60L	possibly damaging	Het
Spryd3	A	T	15: 102,131,937	H59Q	probably benign	Het
Sqstm1	T	C	11: 50,203,022	D256G	probably damaging	Het
Sst	A	T	16: 23,889,737	S115T	probably damaging	Het
Surf1	T	C	2: 26,915,951		probably benign	Het
Synj1	A	T	16: 91,009,977		probably benign	Het
Tet1	C	A	10: 62,878,294	C574F	probably damaging	Het
Thnsl1	T	A	2: 21,212,390	Y318*	probably null	Het
Tmem110	A	G	14: 30,870,819	K166E	probably damaging	Het
Tomm70a	A	G	16: 57,122,130	E90G	probably damaging	Het
Treml4	A	G	17: 48,264,899	D110G	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Txnl1	C	T	18: 63,664,325	G283D	probably damaging	Het
Uba6	T	C	5: 86,135,047	D559G	probably damaging	Het
Usp4	T	C	9: 108,356,462	V94A	possibly damaging	Het
Vmn2r25	A	C	6: 123,825,296	C549W	probably damaging	Het
Vmn2r59	G	T	7: 42,045,681	Q436K	probably benign	Het
Wdr70	A	T	15: 7,884,288	Y627N	possibly damaging	Het
Xpr1	T	C	1: 155,312,863	I344V	probably benign	Het
Zfp423	T	A	8: 87,859,340	Q61L	possibly damaging	Het

Other mutations in Arhgap5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00679:Arhgap5	APN	12	52517281	missense	probably damaging	0.98
IGL00823:Arhgap5	APN	12	52518742	missense	possibly damaging	0.84
IGL01161:Arhgap5	APN	12	52516860	missense	probably damaging	1.00
IGL01360:Arhgap5	APN	12	52518240	missense	probably damaging	1.00
IGL01910:Arhgap5	APN	12	52516861	missense	probably benign	0.33
IGL02417:Arhgap5	APN	12	52518353	missense	probably damaging	0.99
IGL02448:Arhgap5	APN	12	52562340	missense	probably damaging	0.97
IGL02813:Arhgap5	APN	12	52516965	missense	probably benign	0.20
IGL03398:Arhgap5	APN	12	52517311	missense	probably damaging	0.99
Decline	UTSW	12	52516582	nonsense	probably null
Pass	UTSW	12	52516507	missense	possibly damaging	0.82
3-1:Arhgap5	UTSW	12	52518882	missense	possibly damaging	0.54
R0039:Arhgap5	UTSW	12	52518735	nonsense	probably null
R0088:Arhgap5	UTSW	12	52516548	missense	probably damaging	1.00
R0104:Arhgap5	UTSW	12	52516717	missense	probably damaging	1.00
R0111:Arhgap5	UTSW	12	52559960	splice site	probably benign
R0356:Arhgap5	UTSW	12	52516308	missense	probably damaging	1.00
R0616:Arhgap5	UTSW	12	52517065	missense	possibly damaging	0.79
R0707:Arhgap5	UTSW	12	52518168	missense	probably damaging	1.00
R0718:Arhgap5	UTSW	12	52516507	missense	possibly damaging	0.82
R0849:Arhgap5	UTSW	12	52519623	missense	probably benign	0.01
R0975:Arhgap5	UTSW	12	52517144	missense	possibly damaging	0.61
R1326:Arhgap5	UTSW	12	52518370	missense	possibly damaging	0.80
R1421:Arhgap5	UTSW	12	52516848	missense	probably damaging	1.00
R1422:Arhgap5	UTSW	12	52519514	missense	probably damaging	1.00
R1625:Arhgap5	UTSW	12	52517376	missense	probably benign
R1711:Arhgap5	UTSW	12	52519345	missense	probably damaging	1.00
R1970:Arhgap5	UTSW	12	52542593	missense	probably damaging	1.00
R2004:Arhgap5	UTSW	12	52518034	missense	probably benign	0.05
R2356:Arhgap5	UTSW	12	52519147	missense	probably benign	0.00
R3792:Arhgap5	UTSW	12	52519888	missense	probably benign	0.21
R3808:Arhgap5	UTSW	12	52567187	missense	possibly damaging	0.72
R4458:Arhgap5	UTSW	12	52517957	missense	probably benign
R4703:Arhgap5	UTSW	12	52517583	missense	probably damaging	0.99
R4736:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4737:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4740:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4768:Arhgap5	UTSW	12	52557492	missense	probably damaging	1.00
R4806:Arhgap5	UTSW	12	52518703	missense	probably damaging	0.99
R4817:Arhgap5	UTSW	12	52519209	missense	possibly damaging	0.71
R5681:Arhgap5	UTSW	12	52519779	missense	probably benign	0.21
R5683:Arhgap5	UTSW	12	52519586	missense	probably benign
R5911:Arhgap5	UTSW	12	52518742	missense	possibly damaging	0.84
R6448:Arhgap5	UTSW	12	52517663	missense	probably benign	0.11
R6887:Arhgap5	UTSW	12	52519144	missense	probably benign
R6988:Arhgap5	UTSW	12	52518125	missense	possibly damaging	0.94
R7009:Arhgap5	UTSW	12	52519639	missense	probably benign	0.03
R7013:Arhgap5	UTSW	12	52518326	missense	probably benign	0.05
R7239:Arhgap5	UTSW	12	52517376	missense	probably benign
R7310:Arhgap5	UTSW	12	52542487	critical splice acceptor site	probably null
R7339:Arhgap5	UTSW	12	52517698	missense	possibly damaging	0.64
R7375:Arhgap5	UTSW	12	52516582	nonsense	probably null
R7421:Arhgap5	UTSW	12	52518000	missense	probably benign	0.42
R7442:Arhgap5	UTSW	12	52516956	missense	probably benign	0.25
R7842:Arhgap5	UTSW	12	52518697	missense	possibly damaging	0.78
R8079:Arhgap5	UTSW	12	52567205	missense	probably benign
R8241:Arhgap5	UTSW	12	52518315	missense	probably benign	0.00
R8419:Arhgap5	UTSW	12	52518789	missense	probably damaging	1.00
R9138:Arhgap5	UTSW	12	52562363	missense	probably benign	0.05
X0018:Arhgap5	UTSW	12	52518397	missense	probably damaging	1.00
Z1176:Arhgap5	UTSW	12	52518463	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GTAAAGCCAAGTCATACTACAGAAG -3'
(R):5'- TCAGCCTTCTATTCCAAGTAAAGCATC -3'

Sequencing Primer
(F):5'- GAACACACTCAGATGCAAGCGATG -3'
(R):5'- ACAACAAAAACAAATCTATCCCTACC -3'

Posted On

2016-10-26