Incidental Mutation 'R5586:Wdr70'
ID 438759
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene Name WD repeat domain 70
Synonyms 4833422F06Rik
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 7902536-8128693 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7913769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 627 (Y627N)
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000045766
AA Change: Y627N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828
AA Change: Y627N

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226928
Meta Mutation Damage Score 0.6078 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,277,153 (GRCm39) noncoding transcript Het
Aaas A T 15: 102,255,111 (GRCm39) probably null Het
Abcc3 G A 11: 94,255,247 (GRCm39) R600W probably damaging Het
Abhd13 A T 8: 10,038,318 (GRCm39) Q305L probably benign Het
Adcy5 A T 16: 34,977,486 (GRCm39) I340F probably damaging Het
Adgrl3 T A 5: 81,871,994 (GRCm39) I964N probably damaging Het
Anks1b T A 10: 89,912,926 (GRCm39) H316Q probably damaging Het
Ap3d1 A T 10: 80,554,964 (GRCm39) F454I possibly damaging Het
Apol7c T C 15: 77,410,599 (GRCm39) R116G possibly damaging Het
Arhgap5 A G 12: 52,566,695 (GRCm39) E1222G possibly damaging Het
AW551984 A G 9: 39,502,559 (GRCm39) V673A probably benign Het
Baiap2l1 A G 5: 144,218,949 (GRCm39) S220P probably damaging Het
Bcl6 A G 16: 23,791,926 (GRCm39) F143L probably benign Het
Calb1 A T 4: 15,900,811 (GRCm39) T165S probably benign Het
Ccdc66 C A 14: 27,228,668 (GRCm39) G6C probably damaging Het
Ccdc88a A G 11: 29,453,484 (GRCm39) I344V probably benign Het
Cdh19 T A 1: 110,857,587 (GRCm39) D249V probably damaging Het
Ces1c T A 8: 93,854,227 (GRCm39) T103S probably benign Het
Cfap54 T A 10: 92,808,473 (GRCm39) K1401* probably null Het
Copa T A 1: 171,932,789 (GRCm39) N371K probably damaging Het
Cyp2b10 A T 7: 25,616,437 (GRCm39) Y348F probably damaging Het
Dennd5a T C 7: 109,504,928 (GRCm39) R861G possibly damaging Het
Dhx8 T C 11: 101,623,862 (GRCm39) probably benign Het
Dido1 C T 2: 180,301,445 (GRCm39) W2153* probably null Het
Dlgap1 T A 17: 71,125,156 (GRCm39) V969D probably damaging Het
Dvl3 A G 16: 20,336,039 (GRCm39) D32G probably damaging Het
Epdr1 T C 13: 19,778,718 (GRCm39) D24G probably benign Het
Etnk2 T A 1: 133,307,043 (GRCm39) probably null Het
Fhad1 C T 4: 141,632,442 (GRCm39) M1232I probably benign Het
Gcnt2 A C 13: 41,014,429 (GRCm39) E200A probably damaging Het
Gm5174 A G 10: 86,492,409 (GRCm39) noncoding transcript Het
Gm6408 T A 5: 146,421,267 (GRCm39) F299I possibly damaging Het
Gpr85 G T 6: 13,836,000 (GRCm39) Y301* probably null Het
Gucy2e G T 11: 69,117,082 (GRCm39) P780T probably damaging Het
Icam5 A T 9: 20,946,116 (GRCm39) N316I probably damaging Het
Ifit1bl1 C T 19: 34,571,677 (GRCm39) R260Q probably damaging Het
Il1r1 A C 1: 40,264,411 (GRCm39) probably benign Het
Kif3c A T 12: 3,439,656 (GRCm39) I86F probably benign Het
Klhdc2 A G 12: 69,354,467 (GRCm39) probably null Het
Mast2 A G 4: 116,292,760 (GRCm39) L9P probably damaging Het
Mcoln1 G T 8: 3,560,389 (GRCm39) C316F probably damaging Het
Mon1a A T 9: 107,775,894 (GRCm39) D4V probably damaging Het
Ms4a18 T A 19: 10,991,038 (GRCm39) M19L probably benign Het
Nbea T C 3: 55,539,392 (GRCm39) K2790E probably benign Het
Niban1 C T 1: 151,593,307 (GRCm39) T664I probably benign Het
Noc3l C T 19: 38,803,139 (GRCm39) E167K possibly damaging Het
Nol10 G A 12: 17,466,829 (GRCm39) E570K possibly damaging Het
Nr2e3 T C 9: 59,856,484 (GRCm39) R69G probably damaging Het
Obscn G A 11: 58,892,294 (GRCm39) R1358* probably null Het
Or14j4 A T 17: 37,921,145 (GRCm39) F166I probably damaging Het
Or2b7 C A 13: 21,739,266 (GRCm39) V309F probably damaging Het
Or52e8b A G 7: 104,673,428 (GRCm39) I253T probably damaging Het
Or5b117 A T 19: 13,431,746 (GRCm39) M45K probably benign Het
Pak2 A T 16: 31,860,337 (GRCm39) D175E probably benign Het
Pccb C T 9: 100,867,856 (GRCm39) V357I possibly damaging Het
Pcdhb4 C T 18: 37,442,034 (GRCm39) P448L probably damaging Het
Pcdhb9 A G 18: 37,534,167 (GRCm39) M54V probably benign Het
Ppp3cb A G 14: 20,570,758 (GRCm39) probably benign Het
Ppp4r1 A G 17: 66,131,563 (GRCm39) D452G probably benign Het
Pramel18 T A 4: 101,767,317 (GRCm39) F189I probably benign Het
Prmt3 T A 7: 49,476,499 (GRCm39) D369E probably damaging Het
Psmd12 T A 11: 107,377,301 (GRCm39) V120D probably benign Het
Ptprb T C 10: 116,189,732 (GRCm39) L1797P probably damaging Het
Ptprm A G 17: 67,227,191 (GRCm39) S653P probably damaging Het
Pxdn T A 12: 30,053,141 (GRCm39) V926D probably damaging Het
Retreg3 T G 11: 100,997,165 (GRCm39) Q105P probably damaging Het
Sacs A T 14: 61,443,890 (GRCm39) R1979* probably null Het
Scn2a T A 2: 65,537,639 (GRCm39) L696* probably null Het
Sema3c A T 5: 17,916,422 (GRCm39) N465Y probably damaging Het
Slc25a32 A T 15: 38,963,308 (GRCm39) V171E possibly damaging Het
Slc30a7 C T 3: 115,783,700 (GRCm39) V158I probably benign Het
Slc44a5 G A 3: 153,975,802 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,685,045 (GRCm39) D140G probably damaging Het
Slc7a11 G A 3: 50,397,532 (GRCm39) S60L possibly damaging Het
Spryd3 A T 15: 102,040,372 (GRCm39) H59Q probably benign Het
Sqstm1 T C 11: 50,093,849 (GRCm39) D256G probably damaging Het
Sst A T 16: 23,708,487 (GRCm39) S115T probably damaging Het
Stimate A G 14: 30,592,776 (GRCm39) K166E probably damaging Het
Surf1 T C 2: 26,805,963 (GRCm39) probably benign Het
Synj1 A T 16: 90,806,865 (GRCm39) probably benign Het
Tet1 C A 10: 62,714,073 (GRCm39) C574F probably damaging Het
Thnsl1 T A 2: 21,217,201 (GRCm39) Y318* probably null Het
Tomm70a A G 16: 56,942,493 (GRCm39) E90G probably damaging Het
Treml4 A G 17: 48,571,927 (GRCm39) D110G probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl1 C T 18: 63,797,396 (GRCm39) G283D probably damaging Het
Uba6 T C 5: 86,282,906 (GRCm39) D559G probably damaging Het
Usp4 T C 9: 108,233,661 (GRCm39) V94A possibly damaging Het
Vmn2r25 A C 6: 123,802,255 (GRCm39) C549W probably damaging Het
Vmn2r59 G T 7: 41,695,105 (GRCm39) Q436K probably benign Het
Xpr1 T C 1: 155,188,609 (GRCm39) I344V probably benign Het
Zfp423 T A 8: 88,585,968 (GRCm39) Q61L possibly damaging Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8,049,088 (GRCm39) missense probably benign 0.07
IGL01121:Wdr70 APN 15 7,902,655 (GRCm39) missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8,108,747 (GRCm39) missense probably benign 0.33
IGL01801:Wdr70 APN 15 7,916,805 (GRCm39) splice site probably null
IGL01815:Wdr70 APN 15 7,916,805 (GRCm39) splice site probably null
IGL01929:Wdr70 APN 15 7,950,115 (GRCm39) splice site probably null
IGL02150:Wdr70 APN 15 8,112,030 (GRCm39) missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8,075,965 (GRCm39) missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7,913,783 (GRCm39) nonsense probably null
IGL02800:Wdr70 APN 15 8,111,980 (GRCm39) missense probably benign 0.25
IGL02829:Wdr70 APN 15 8,006,463 (GRCm39) missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7,913,787 (GRCm39) missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7,913,821 (GRCm39) missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8,065,352 (GRCm39) missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8,049,068 (GRCm39) critical splice donor site probably null
R0106:Wdr70 UTSW 15 8,049,068 (GRCm39) critical splice donor site probably null
R0462:Wdr70 UTSW 15 8,108,645 (GRCm39) missense probably benign 0.00
R0539:Wdr70 UTSW 15 7,915,118 (GRCm39) missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8,065,325 (GRCm39) missense probably benign 0.01
R1812:Wdr70 UTSW 15 8,108,663 (GRCm39) missense probably benign 0.00
R1863:Wdr70 UTSW 15 7,950,054 (GRCm39) missense probably benign 0.25
R1913:Wdr70 UTSW 15 7,913,891 (GRCm39) missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7,916,840 (GRCm39) nonsense probably null
R4013:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4015:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4017:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4111:Wdr70 UTSW 15 8,006,472 (GRCm39) missense probably benign 0.32
R5241:Wdr70 UTSW 15 8,108,700 (GRCm39) missense probably benign
R5277:Wdr70 UTSW 15 8,006,465 (GRCm39) nonsense probably null
R5306:Wdr70 UTSW 15 7,953,754 (GRCm39) missense probably benign 0.04
R5426:Wdr70 UTSW 15 7,951,586 (GRCm39) missense possibly damaging 0.59
R6010:Wdr70 UTSW 15 7,916,900 (GRCm39) splice site probably null
R6035:Wdr70 UTSW 15 7,916,830 (GRCm39) missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7,916,830 (GRCm39) missense possibly damaging 0.86
R6109:Wdr70 UTSW 15 8,108,638 (GRCm39) splice site probably null
R6139:Wdr70 UTSW 15 8,108,735 (GRCm39) missense probably benign 0.04
R6400:Wdr70 UTSW 15 8,072,322 (GRCm39) missense probably benign 0.32
R6456:Wdr70 UTSW 15 7,915,118 (GRCm39) missense possibly damaging 0.96
R6518:Wdr70 UTSW 15 8,108,821 (GRCm39) missense unknown
R7036:Wdr70 UTSW 15 7,913,855 (GRCm39) missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7,913,877 (GRCm39) missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7,953,725 (GRCm39) missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7,951,562 (GRCm39) missense probably benign 0.23
R7572:Wdr70 UTSW 15 8,065,327 (GRCm39) missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8,108,700 (GRCm39) missense probably benign
R7886:Wdr70 UTSW 15 8,108,733 (GRCm39) missense probably benign 0.02
R8103:Wdr70 UTSW 15 8,006,612 (GRCm39) missense possibly damaging 0.70
R8214:Wdr70 UTSW 15 7,916,851 (GRCm39) missense probably benign 0.03
R8252:Wdr70 UTSW 15 8,072,337 (GRCm39) splice site probably benign
R8869:Wdr70 UTSW 15 8,123,210 (GRCm39) missense probably benign 0.02
R9203:Wdr70 UTSW 15 7,902,684 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCATTCTTTGTGCTCAAATAG -3'
(R):5'- TCTCTGAAACAGGTCGTGGTG -3'

Sequencing Primer
(F):5'- ACGAATATGCCATGGCCTG -3'
(R):5'- TGGTGGCCGAGTTGGAACC -3'
Posted On 2016-10-26