Mutagenetix > Incidental Mutation

Incidental Mutation 'R5586:Bcl6'

438766

Institutional Source

Beutler Lab

Gene Symbol

Bcl6

Ensembl Gene

ENSMUSG00000022508

Gene Name

B cell leukemia/lymphoma 6

Synonyms

Bcl5

MMRRC Submission

043140-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R5586 (G1)

Quality Score

182

Status

Validated

Chromosome

Chromosomal Location

23965052-23988852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23973176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 143 (F143L)

Ref Sequence

ENSEMBL: ENSMUSP00000023151 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023151]

AlphaFold

P41183

Predicted Effect

probably benign
Transcript: ENSMUST00000023151
AA Change: F143L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508
AA Change: F143L

Domain	Start	End	E-Value	Type
BTB	32	129	4.86e-28	SMART
low complexity region	406	422	N/A	INTRINSIC
low complexity region	458	467	N/A	INTRINSIC
ZnF_C2H2	519	542	1.33e-1	SMART
ZnF_C2H2	547	569	1.67e-2	SMART
ZnF_C2H2	575	597	2.79e-4	SMART
ZnF_C2H2	603	625	3.89e-3	SMART
ZnF_C2H2	631	653	8.47e-4	SMART
ZnF_C2H2	659	682	4.11e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135352

Meta Mutation Damage Score

0.0641

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

98% (101/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,577,728		noncoding transcript	Het
Aaas	A	T	15: 102,346,676		probably null	Het
Abcc3	G	A	11: 94,364,421	R600W	probably damaging	Het
Abhd13	A	T	8: 9,988,318	Q305L	probably benign	Het
Adcy5	A	T	16: 35,157,116	I340F	probably damaging	Het
Adgrl3	T	A	5: 81,724,147	I964N	probably damaging	Het
Anks1b	T	A	10: 90,077,064	H316Q	probably damaging	Het
Ap3d1	A	T	10: 80,719,130	F454I	possibly damaging	Het
Apol7c	T	C	15: 77,526,399	R116G	possibly damaging	Het
Arhgap5	A	G	12: 52,519,912	E1222G	possibly damaging	Het
AW551984	A	G	9: 39,591,263	V673A	probably benign	Het
Baiap2l1	A	G	5: 144,282,139	S220P	probably damaging	Het
Calb1	A	T	4: 15,900,811	T165S	probably benign	Het
Ccdc66	C	A	14: 27,506,711	G6C	probably damaging	Het
Ccdc88a	A	G	11: 29,503,484	I344V	probably benign	Het
Cdh19	T	A	1: 110,929,857	D249V	probably damaging	Het
Ces1c	T	A	8: 93,127,599	T103S	probably benign	Het
Cfap54	T	A	10: 92,972,611	K1401*	probably null	Het
Copa	T	A	1: 172,105,222	N371K	probably damaging	Het
Cyp2b10	A	T	7: 25,917,012	Y348F	probably damaging	Het
Dennd5a	T	C	7: 109,905,721	R861G	possibly damaging	Het
Dhx8	T	C	11: 101,733,036		probably benign	Het
Dido1	C	T	2: 180,659,652	W2153*	probably null	Het
Dlgap1	T	A	17: 70,818,161	V969D	probably damaging	Het
Dvl3	A	G	16: 20,517,289	D32G	probably damaging	Het
Epdr1	T	C	13: 19,594,548	D24G	probably benign	Het
Etnk2	T	A	1: 133,379,305		probably null	Het
Fam129a	C	T	1: 151,717,556	T664I	probably benign	Het
Fhad1	C	T	4: 141,905,131	M1232I	probably benign	Het
Gcnt2	A	C	13: 40,860,953	E200A	probably damaging	Het
Gm12800	T	A	4: 101,910,120	F189I	probably benign	Het
Gm5174	A	G	10: 86,656,545		noncoding transcript	Het
Gm6408	T	A	5: 146,484,457	F299I	possibly damaging	Het
Gpr85	G	T	6: 13,836,001	Y301*	probably null	Het
Gucy2e	G	T	11: 69,226,256	P780T	probably damaging	Het
Icam5	A	T	9: 21,034,820	N316I	probably damaging	Het
Ifit1bl1	C	T	19: 34,594,277	R260Q	probably damaging	Het
Il1r1	A	C	1: 40,225,251		probably benign	Het
Kif3c	A	T	12: 3,389,656	I86F	probably benign	Het
Klhdc2	A	G	12: 69,307,693		probably null	Het
Mast2	A	G	4: 116,435,563	L9P	probably damaging	Het
Mcoln1	G	T	8: 3,510,389	C316F	probably damaging	Het
Mon1a	A	T	9: 107,898,695	D4V	probably damaging	Het
Ms4a18	T	A	19: 11,013,674	M19L	probably benign	Het
Nbea	T	C	3: 55,631,971	K2790E	probably benign	Het
Noc3l	C	T	19: 38,814,695	E167K	possibly damaging	Het
Nol10	G	A	12: 17,416,828	E570K	possibly damaging	Het
Nr2e3	T	C	9: 59,949,201	R69G	probably damaging	Het
Obscn	G	A	11: 59,001,468	R1358*	probably null	Het
Olfr115	A	T	17: 37,610,254	F166I	probably damaging	Het
Olfr1472	A	T	19: 13,454,382	M45K	probably benign	Het
Olfr1535	C	A	13: 21,555,096	V309F	probably damaging	Het
Olfr675	A	G	7: 105,024,221	I253T	probably damaging	Het
Pak2	A	T	16: 32,041,519	D175E	probably benign	Het
Pccb	C	T	9: 100,985,803	V357I	possibly damaging	Het
Pcdhb4	C	T	18: 37,308,981	P448L	probably damaging	Het
Pcdhb9	A	G	18: 37,401,114	M54V	probably benign	Het
Ppp3cb	A	G	14: 20,520,690		probably benign	Het
Ppp4r1	A	G	17: 65,824,568	D452G	probably benign	Het
Prmt3	T	A	7: 49,826,751	D369E	probably damaging	Het
Psmd12	T	A	11: 107,486,475	V120D	probably benign	Het
Ptprb	T	C	10: 116,353,827	L1797P	probably damaging	Het
Ptprm	A	G	17: 66,920,196	S653P	probably damaging	Het
Pxdn	T	A	12: 30,003,142	V926D	probably damaging	Het
Retreg3	T	G	11: 101,106,339	Q105P	probably damaging	Het
Sacs	A	T	14: 61,206,441	R1979*	probably null	Het
Scn2a	T	A	2: 65,707,295	L696*	probably null	Het
Sema3c	A	T	5: 17,711,424	N465Y	probably damaging	Het
Slc25a32	A	T	15: 39,099,913	V171E	possibly damaging	Het
Slc30a7	C	T	3: 115,990,051	V158I	probably benign	Het
Slc44a5	G	A	3: 154,270,165		probably benign	Het
Slc4a8	A	G	15: 100,787,164	D140G	probably damaging	Het
Slc7a11	G	A	3: 50,443,083	S60L	possibly damaging	Het
Spryd3	A	T	15: 102,131,937	H59Q	probably benign	Het
Sqstm1	T	C	11: 50,203,022	D256G	probably damaging	Het
Sst	A	T	16: 23,889,737	S115T	probably damaging	Het
Surf1	T	C	2: 26,915,951		probably benign	Het
Synj1	A	T	16: 91,009,977		probably benign	Het
Tet1	C	A	10: 62,878,294	C574F	probably damaging	Het
Thnsl1	T	A	2: 21,212,390	Y318*	probably null	Het
Tmem110	A	G	14: 30,870,819	K166E	probably damaging	Het
Tomm70a	A	G	16: 57,122,130	E90G	probably damaging	Het
Treml4	A	G	17: 48,264,899	D110G	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Txnl1	C	T	18: 63,664,325	G283D	probably damaging	Het
Uba6	T	C	5: 86,135,047	D559G	probably damaging	Het
Usp4	T	C	9: 108,356,462	V94A	possibly damaging	Het
Vmn2r25	A	C	6: 123,825,296	C549W	probably damaging	Het
Vmn2r59	G	T	7: 42,045,681	Q436K	probably benign	Het
Wdr70	A	T	15: 7,884,288	Y627N	possibly damaging	Het
Xpr1	T	C	1: 155,312,863	I344V	probably benign	Het
Zfp423	T	A	8: 87,859,340	Q61L	possibly damaging	Het

Other mutations in Bcl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02220:Bcl6	APN	16	23974891	missense	probably damaging	1.00
IGL02505:Bcl6	APN	16	23977569	missense	probably damaging	1.00
IGL03052:Bcl6	APN	16	23975038	splice site	probably benign
IGL03271:Bcl6	APN	16	23970006	missense	probably benign	0.00
Adriatic	UTSW	16	23968133	missense	probably damaging	0.99
Catanzaro	UTSW	16	23966226	nonsense	probably null
Density	UTSW	16	23970048	missense	possibly damaging	0.91
nouvelle	UTSW	16	23969986	missense	possibly damaging	0.92
R0220:Bcl6	UTSW	16	23966219	missense	possibly damaging	0.95
R0401:Bcl6	UTSW	16	23972594	missense	probably damaging	0.97
R0734:Bcl6	UTSW	16	23968139	missense	probably damaging	0.99
R1105:Bcl6	UTSW	16	23966155	missense	probably benign
R1134:Bcl6	UTSW	16	23968365	missense	probably benign
R1317:Bcl6	UTSW	16	23977542	missense	probably damaging	1.00
R1325:Bcl6	UTSW	16	23972347	missense	probably benign	0.02
R1393:Bcl6	UTSW	16	23977566	missense	probably damaging	0.99
R1761:Bcl6	UTSW	16	23977542	missense	probably damaging	1.00
R2170:Bcl6	UTSW	16	23974930	missense	probably damaging	1.00
R2220:Bcl6	UTSW	16	23972632	nonsense	probably null
R2293:Bcl6	UTSW	16	23977609	missense	probably damaging	0.98
R2907:Bcl6	UTSW	16	23968119	missense	probably damaging	1.00
R3900:Bcl6	UTSW	16	23977554	missense	possibly damaging	0.94
R4681:Bcl6	UTSW	16	23968453	intron	probably benign
R5015:Bcl6	UTSW	16	23974850	missense	probably damaging	0.98
R5112:Bcl6	UTSW	16	23972746	missense	probably benign
R5185:Bcl6	UTSW	16	23972947	missense	possibly damaging	0.77
R5371:Bcl6	UTSW	16	23969986	missense	possibly damaging	0.92
R5659:Bcl6	UTSW	16	23968409	nonsense	probably null
R5909:Bcl6	UTSW	16	23972806	missense	probably benign
R6384:Bcl6	UTSW	16	23974865	missense	probably damaging	1.00
R7036:Bcl6	UTSW	16	23974861	missense	probably damaging	1.00
R7097:Bcl6	UTSW	16	23972614	missense	possibly damaging	0.94
R7097:Bcl6	UTSW	16	23972902	missense	probably damaging	1.00
R7122:Bcl6	UTSW	16	23972902	missense	probably damaging	1.00
R7153:Bcl6	UTSW	16	23966226	nonsense	probably null
R7154:Bcl6	UTSW	16	23966226	nonsense	probably null
R7155:Bcl6	UTSW	16	23966226	nonsense	probably null
R7156:Bcl6	UTSW	16	23966226	nonsense	probably null
R7163:Bcl6	UTSW	16	23966226	nonsense	probably null
R7164:Bcl6	UTSW	16	23966226	nonsense	probably null
R7434:Bcl6	UTSW	16	23970048	missense	possibly damaging	0.91
R7727:Bcl6	UTSW	16	23971413	critical splice donor site	probably null
R7914:Bcl6	UTSW	16	23970011	missense	possibly damaging	0.68
R8230:Bcl6	UTSW	16	23972902	missense	probably damaging	1.00
R8243:Bcl6	UTSW	16	23968133	missense	probably damaging	0.99
R8399:Bcl6	UTSW	16	23972948	missense	probably benign	0.39
R8951:Bcl6	UTSW	16	23974954	missense	probably damaging	1.00
R8956:Bcl6	UTSW	16	23974966	missense	probably damaging	0.99
R9401:Bcl6	UTSW	16	23972357	missense	possibly damaging	0.77
R9471:Bcl6	UTSW	16	23973107	missense	probably benign	0.32
Z1176:Bcl6	UTSW	16	23969958	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGAGCTCCTCATCAGAGAAGAG -3'
(R):5'- AGTCTGTTTTCCGACTCCAGAG -3'

Sequencing Primer
(F):5'- CTGAGCGGGAGATGGCTGTAC -3'
(R):5'- GTGTCACTGGAAGGTCAT -3'

Posted On

2016-10-26