Incidental Mutation 'R5586:Bcl6'
ID438766
Institutional Source Beutler Lab
Gene Symbol Bcl6
Ensembl Gene ENSMUSG00000022508
Gene NameB cell leukemia/lymphoma 6
SynonymsBcl5
MMRRC Submission 043140-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5586 (G1)
Quality Score182
Status Validated
Chromosome16
Chromosomal Location23965052-23988852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23973176 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 143 (F143L)
Ref Sequence ENSEMBL: ENSMUSP00000023151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023151]
Predicted Effect probably benign
Transcript: ENSMUST00000023151
AA Change: F143L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508
AA Change: F143L

DomainStartEndE-ValueType
BTB 32 129 4.86e-28 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
ZnF_C2H2 519 542 1.33e-1 SMART
ZnF_C2H2 547 569 1.67e-2 SMART
ZnF_C2H2 575 597 2.79e-4 SMART
ZnF_C2H2 603 625 3.89e-3 SMART
ZnF_C2H2 631 653 8.47e-4 SMART
ZnF_C2H2 659 682 4.11e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135352
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,577,728 noncoding transcript Het
Aaas A T 15: 102,346,676 probably null Het
Abcc3 G A 11: 94,364,421 R600W probably damaging Het
Abhd13 A T 8: 9,988,318 Q305L probably benign Het
Adcy5 A T 16: 35,157,116 I340F probably damaging Het
Adgrl3 T A 5: 81,724,147 I964N probably damaging Het
Anks1b T A 10: 90,077,064 H316Q probably damaging Het
Ap3d1 A T 10: 80,719,130 F454I possibly damaging Het
Apol7c T C 15: 77,526,399 R116G possibly damaging Het
Arhgap5 A G 12: 52,519,912 E1222G possibly damaging Het
AW551984 A G 9: 39,591,263 V673A probably benign Het
Baiap2l1 A G 5: 144,282,139 S220P probably damaging Het
Calb1 A T 4: 15,900,811 T165S probably benign Het
Ccdc66 C A 14: 27,506,711 G6C probably damaging Het
Ccdc88a A G 11: 29,503,484 I344V probably benign Het
Cdh19 T A 1: 110,929,857 D249V probably damaging Het
Ces1c T A 8: 93,127,599 T103S probably benign Het
Cfap54 T A 10: 92,972,611 K1401* probably null Het
Copa T A 1: 172,105,222 N371K probably damaging Het
Cyp2b10 A T 7: 25,917,012 Y348F probably damaging Het
Dennd5a T C 7: 109,905,721 R861G possibly damaging Het
Dhx8 T C 11: 101,733,036 probably benign Het
Dido1 C T 2: 180,659,652 W2153* probably null Het
Dlgap1 T A 17: 70,818,161 V969D probably damaging Het
Dvl3 A G 16: 20,517,289 D32G probably damaging Het
Epdr1 T C 13: 19,594,548 D24G probably benign Het
Etnk2 T A 1: 133,379,305 probably null Het
Fam129a C T 1: 151,717,556 T664I probably benign Het
Fhad1 C T 4: 141,905,131 M1232I probably benign Het
Gcnt2 A C 13: 40,860,953 E200A probably damaging Het
Gm12800 T A 4: 101,910,120 F189I probably benign Het
Gm5174 A G 10: 86,656,545 noncoding transcript Het
Gm6408 T A 5: 146,484,457 F299I possibly damaging Het
Gpr85 G T 6: 13,836,001 Y301* probably null Het
Gucy2e G T 11: 69,226,256 P780T probably damaging Het
Icam5 A T 9: 21,034,820 N316I probably damaging Het
Ifit1bl1 C T 19: 34,594,277 R260Q probably damaging Het
Il1r1 A C 1: 40,225,251 probably benign Het
Kif3c A T 12: 3,389,656 I86F probably benign Het
Klhdc2 A G 12: 69,307,693 probably null Het
Mast2 A G 4: 116,435,563 L9P probably damaging Het
Mcoln1 G T 8: 3,510,389 C316F probably damaging Het
Mon1a A T 9: 107,898,695 D4V probably damaging Het
Ms4a18 T A 19: 11,013,674 M19L probably benign Het
Nbea T C 3: 55,631,971 K2790E probably benign Het
Noc3l C T 19: 38,814,695 E167K possibly damaging Het
Nol10 G A 12: 17,416,828 E570K possibly damaging Het
Nr2e3 T C 9: 59,949,201 R69G probably damaging Het
Obscn G A 11: 59,001,468 R1358* probably null Het
Olfr115 A T 17: 37,610,254 F166I probably damaging Het
Olfr1472 A T 19: 13,454,382 M45K probably benign Het
Olfr1535 C A 13: 21,555,096 V309F probably damaging Het
Olfr675 A G 7: 105,024,221 I253T probably damaging Het
Pak2 A T 16: 32,041,519 D175E probably benign Het
Pccb C T 9: 100,985,803 V357I possibly damaging Het
Pcdhb4 C T 18: 37,308,981 P448L probably damaging Het
Pcdhb9 A G 18: 37,401,114 M54V probably benign Het
Ppp3cb A G 14: 20,520,690 probably benign Het
Ppp4r1 A G 17: 65,824,568 D452G probably benign Het
Prmt3 T A 7: 49,826,751 D369E probably damaging Het
Psmd12 T A 11: 107,486,475 V120D probably benign Het
Ptprb T C 10: 116,353,827 L1797P probably damaging Het
Ptprm A G 17: 66,920,196 S653P probably damaging Het
Pxdn T A 12: 30,003,142 V926D probably damaging Het
Retreg3 T G 11: 101,106,339 Q105P probably damaging Het
Sacs A T 14: 61,206,441 R1979* probably null Het
Scn2a T A 2: 65,707,295 L696* probably null Het
Sema3c A T 5: 17,711,424 N465Y probably damaging Het
Slc25a32 A T 15: 39,099,913 V171E possibly damaging Het
Slc30a7 C T 3: 115,990,051 V158I probably benign Het
Slc44a5 G A 3: 154,270,165 probably benign Het
Slc4a8 A G 15: 100,787,164 D140G probably damaging Het
Slc7a11 G A 3: 50,443,083 S60L possibly damaging Het
Spryd3 A T 15: 102,131,937 H59Q probably benign Het
Sqstm1 T C 11: 50,203,022 D256G probably damaging Het
Sst A T 16: 23,889,737 S115T probably damaging Het
Surf1 T C 2: 26,915,951 probably benign Het
Synj1 A T 16: 91,009,977 probably benign Het
Tet1 C A 10: 62,878,294 C574F probably damaging Het
Thnsl1 T A 2: 21,212,390 Y318* probably null Het
Tmem110 A G 14: 30,870,819 K166E probably damaging Het
Tomm70a A G 16: 57,122,130 E90G probably damaging Het
Treml4 A G 17: 48,264,899 D110G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 C T 18: 63,664,325 G283D probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Usp4 T C 9: 108,356,462 V94A possibly damaging Het
Vmn2r25 A C 6: 123,825,296 C549W probably damaging Het
Vmn2r59 G T 7: 42,045,681 Q436K probably benign Het
Wdr70 A T 15: 7,884,288 Y627N possibly damaging Het
Xpr1 T C 1: 155,312,863 I344V probably benign Het
Zfp423 T A 8: 87,859,340 Q61L possibly damaging Het
Other mutations in Bcl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcl6 APN 16 23974891 missense probably damaging 1.00
IGL02505:Bcl6 APN 16 23977569 missense probably damaging 1.00
IGL03052:Bcl6 APN 16 23975038 splice site probably benign
IGL03271:Bcl6 APN 16 23970006 missense probably benign 0.00
Adriatic UTSW 16 23968133 missense probably damaging 0.99
Catanzaro UTSW 16 23966226 nonsense probably null
Density UTSW 16 23970048 missense possibly damaging 0.91
nouvelle UTSW 16 23969986 missense possibly damaging 0.92
R0220:Bcl6 UTSW 16 23966219 missense possibly damaging 0.95
R0401:Bcl6 UTSW 16 23972594 missense probably damaging 0.97
R0734:Bcl6 UTSW 16 23968139 missense probably damaging 0.99
R1105:Bcl6 UTSW 16 23966155 missense probably benign
R1134:Bcl6 UTSW 16 23968365 missense probably benign
R1317:Bcl6 UTSW 16 23977542 missense probably damaging 1.00
R1325:Bcl6 UTSW 16 23972347 missense probably benign 0.02
R1393:Bcl6 UTSW 16 23977566 missense probably damaging 0.99
R1761:Bcl6 UTSW 16 23977542 missense probably damaging 1.00
R2170:Bcl6 UTSW 16 23974930 missense probably damaging 1.00
R2220:Bcl6 UTSW 16 23972632 nonsense probably null
R2293:Bcl6 UTSW 16 23977609 missense probably damaging 0.98
R2907:Bcl6 UTSW 16 23968119 missense probably damaging 1.00
R3900:Bcl6 UTSW 16 23977554 missense possibly damaging 0.94
R4681:Bcl6 UTSW 16 23968453 intron probably benign
R5015:Bcl6 UTSW 16 23974850 missense probably damaging 0.98
R5112:Bcl6 UTSW 16 23972746 missense probably benign
R5185:Bcl6 UTSW 16 23972947 missense possibly damaging 0.77
R5371:Bcl6 UTSW 16 23969986 missense possibly damaging 0.92
R5659:Bcl6 UTSW 16 23968409 nonsense probably null
R5909:Bcl6 UTSW 16 23972806 missense probably benign
R6384:Bcl6 UTSW 16 23974865 missense probably damaging 1.00
R7036:Bcl6 UTSW 16 23974861 missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23972614 missense possibly damaging 0.94
R7097:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R7122:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R7153:Bcl6 UTSW 16 23966226 nonsense probably null
R7154:Bcl6 UTSW 16 23966226 nonsense probably null
R7155:Bcl6 UTSW 16 23966226 nonsense probably null
R7156:Bcl6 UTSW 16 23966226 nonsense probably null
R7163:Bcl6 UTSW 16 23966226 nonsense probably null
R7164:Bcl6 UTSW 16 23966226 nonsense probably null
R7434:Bcl6 UTSW 16 23970048 missense possibly damaging 0.91
R7727:Bcl6 UTSW 16 23971413 critical splice donor site probably null
R7914:Bcl6 UTSW 16 23970011 missense possibly damaging 0.68
R8230:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R8243:Bcl6 UTSW 16 23968133 missense probably damaging 0.99
R8399:Bcl6 UTSW 16 23972948 missense probably benign 0.39
Z1176:Bcl6 UTSW 16 23969958 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGCTCCTCATCAGAGAAGAG -3'
(R):5'- AGTCTGTTTTCCGACTCCAGAG -3'

Sequencing Primer
(F):5'- CTGAGCGGGAGATGGCTGTAC -3'
(R):5'- GTGTCACTGGAAGGTCAT -3'
Posted On2016-10-26