Incidental Mutation 'R5586:Pak2'
ID 438767
Institutional Source Beutler Lab
Gene Symbol Pak2
Ensembl Gene ENSMUSG00000022781
Gene Name p21 (RAC1) activated kinase 2
Synonyms A130002K10Rik, PAK-2, 5330420P17Rik, D16Ertd269e
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 32016290-32079342 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32041519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 175 (D175E)
Ref Sequence ENSEMBL: ENSMUSP00000023467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023467]
AlphaFold Q8CIN4
Predicted Effect probably benign
Transcript: ENSMUST00000023467
AA Change: D175E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023467
Gene: ENSMUSG00000022781
AA Change: D175E

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
PBD 74 109 4.83e-16 SMART
low complexity region 170 177 N/A INTRINSIC
low complexity region 212 226 N/A INTRINSIC
S_TKc 249 500 9.34e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125019
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The p21 activated kinases (PAK) are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. The PAK proteins are a family of serine/threonine kinases that serve as targets for the small GTP binding proteins, CDC42 and RAC1, and have been implicated in a wide range of biological activities. The protein encoded by this gene is activated by proteolytic cleavage during caspase-mediated apoptosis, and may play a role in regulating the apoptotic events in the dying cell. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E8 and the postnatal period with prominent head folds, impaired somite development, and growth retardation. Mice homozygous for a knock-in allele exhibit increased cell proliferation and decreased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,577,728 noncoding transcript Het
Aaas A T 15: 102,346,676 probably null Het
Abcc3 G A 11: 94,364,421 R600W probably damaging Het
Abhd13 A T 8: 9,988,318 Q305L probably benign Het
Adcy5 A T 16: 35,157,116 I340F probably damaging Het
Adgrl3 T A 5: 81,724,147 I964N probably damaging Het
Anks1b T A 10: 90,077,064 H316Q probably damaging Het
Ap3d1 A T 10: 80,719,130 F454I possibly damaging Het
Apol7c T C 15: 77,526,399 R116G possibly damaging Het
Arhgap5 A G 12: 52,519,912 E1222G possibly damaging Het
AW551984 A G 9: 39,591,263 V673A probably benign Het
Baiap2l1 A G 5: 144,282,139 S220P probably damaging Het
Bcl6 A G 16: 23,973,176 F143L probably benign Het
Calb1 A T 4: 15,900,811 T165S probably benign Het
Ccdc66 C A 14: 27,506,711 G6C probably damaging Het
Ccdc88a A G 11: 29,503,484 I344V probably benign Het
Cdh19 T A 1: 110,929,857 D249V probably damaging Het
Ces1c T A 8: 93,127,599 T103S probably benign Het
Cfap54 T A 10: 92,972,611 K1401* probably null Het
Copa T A 1: 172,105,222 N371K probably damaging Het
Cyp2b10 A T 7: 25,917,012 Y348F probably damaging Het
Dennd5a T C 7: 109,905,721 R861G possibly damaging Het
Dhx8 T C 11: 101,733,036 probably benign Het
Dido1 C T 2: 180,659,652 W2153* probably null Het
Dlgap1 T A 17: 70,818,161 V969D probably damaging Het
Dvl3 A G 16: 20,517,289 D32G probably damaging Het
Epdr1 T C 13: 19,594,548 D24G probably benign Het
Etnk2 T A 1: 133,379,305 probably null Het
Fam129a C T 1: 151,717,556 T664I probably benign Het
Fhad1 C T 4: 141,905,131 M1232I probably benign Het
Gcnt2 A C 13: 40,860,953 E200A probably damaging Het
Gm12800 T A 4: 101,910,120 F189I probably benign Het
Gm5174 A G 10: 86,656,545 noncoding transcript Het
Gm6408 T A 5: 146,484,457 F299I possibly damaging Het
Gpr85 G T 6: 13,836,001 Y301* probably null Het
Gucy2e G T 11: 69,226,256 P780T probably damaging Het
Icam5 A T 9: 21,034,820 N316I probably damaging Het
Ifit1bl1 C T 19: 34,594,277 R260Q probably damaging Het
Il1r1 A C 1: 40,225,251 probably benign Het
Kif3c A T 12: 3,389,656 I86F probably benign Het
Klhdc2 A G 12: 69,307,693 probably null Het
Mast2 A G 4: 116,435,563 L9P probably damaging Het
Mcoln1 G T 8: 3,510,389 C316F probably damaging Het
Mon1a A T 9: 107,898,695 D4V probably damaging Het
Ms4a18 T A 19: 11,013,674 M19L probably benign Het
Nbea T C 3: 55,631,971 K2790E probably benign Het
Noc3l C T 19: 38,814,695 E167K possibly damaging Het
Nol10 G A 12: 17,416,828 E570K possibly damaging Het
Nr2e3 T C 9: 59,949,201 R69G probably damaging Het
Obscn G A 11: 59,001,468 R1358* probably null Het
Olfr115 A T 17: 37,610,254 F166I probably damaging Het
Olfr1472 A T 19: 13,454,382 M45K probably benign Het
Olfr1535 C A 13: 21,555,096 V309F probably damaging Het
Olfr675 A G 7: 105,024,221 I253T probably damaging Het
Pccb C T 9: 100,985,803 V357I possibly damaging Het
Pcdhb4 C T 18: 37,308,981 P448L probably damaging Het
Pcdhb9 A G 18: 37,401,114 M54V probably benign Het
Ppp3cb A G 14: 20,520,690 probably benign Het
Ppp4r1 A G 17: 65,824,568 D452G probably benign Het
Prmt3 T A 7: 49,826,751 D369E probably damaging Het
Psmd12 T A 11: 107,486,475 V120D probably benign Het
Ptprb T C 10: 116,353,827 L1797P probably damaging Het
Ptprm A G 17: 66,920,196 S653P probably damaging Het
Pxdn T A 12: 30,003,142 V926D probably damaging Het
Retreg3 T G 11: 101,106,339 Q105P probably damaging Het
Sacs A T 14: 61,206,441 R1979* probably null Het
Scn2a T A 2: 65,707,295 L696* probably null Het
Sema3c A T 5: 17,711,424 N465Y probably damaging Het
Slc25a32 A T 15: 39,099,913 V171E possibly damaging Het
Slc30a7 C T 3: 115,990,051 V158I probably benign Het
Slc44a5 G A 3: 154,270,165 probably benign Het
Slc4a8 A G 15: 100,787,164 D140G probably damaging Het
Slc7a11 G A 3: 50,443,083 S60L possibly damaging Het
Spryd3 A T 15: 102,131,937 H59Q probably benign Het
Sqstm1 T C 11: 50,203,022 D256G probably damaging Het
Sst A T 16: 23,889,737 S115T probably damaging Het
Surf1 T C 2: 26,915,951 probably benign Het
Synj1 A T 16: 91,009,977 probably benign Het
Tet1 C A 10: 62,878,294 C574F probably damaging Het
Thnsl1 T A 2: 21,212,390 Y318* probably null Het
Tmem110 A G 14: 30,870,819 K166E probably damaging Het
Tomm70a A G 16: 57,122,130 E90G probably damaging Het
Treml4 A G 17: 48,264,899 D110G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 C T 18: 63,664,325 G283D probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Usp4 T C 9: 108,356,462 V94A possibly damaging Het
Vmn2r25 A C 6: 123,825,296 C549W probably damaging Het
Vmn2r59 G T 7: 42,045,681 Q436K probably benign Het
Wdr70 A T 15: 7,884,288 Y627N possibly damaging Het
Xpr1 T C 1: 155,312,863 I344V probably benign Het
Zfp423 T A 8: 87,859,340 Q61L possibly damaging Het
Other mutations in Pak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Pak2 APN 16 32041544 missense probably benign 0.04
IGL01807:Pak2 APN 16 32037279 missense probably damaging 0.99
IGL02296:Pak2 APN 16 32044002 critical splice acceptor site probably null
IGL02828:Pak2 APN 16 32021856 missense probably damaging 1.00
K7371:Pak2 UTSW 16 32033784 splice site probably benign
PIT4142001:Pak2 UTSW 16 32023112 missense probably damaging 1.00
R0077:Pak2 UTSW 16 32033843 missense possibly damaging 0.93
R1569:Pak2 UTSW 16 32037295 missense probably damaging 1.00
R4179:Pak2 UTSW 16 32052187 missense probably benign 0.02
R4180:Pak2 UTSW 16 32052187 missense probably benign 0.02
R4223:Pak2 UTSW 16 32052210 missense probably benign
R5114:Pak2 UTSW 16 32043118 intron probably benign
R5294:Pak2 UTSW 16 32021830 missense probably damaging 0.99
R5340:Pak2 UTSW 16 32034946 splice site probably null
R5342:Pak2 UTSW 16 32044488 missense probably damaging 1.00
R7590:Pak2 UTSW 16 32052196 missense probably benign 0.27
R7995:Pak2 UTSW 16 32027772 missense possibly damaging 0.92
R8324:Pak2 UTSW 16 32052211 missense probably benign 0.00
R8485:Pak2 UTSW 16 32052265 missense probably benign 0.16
R8948:Pak2 UTSW 16 32033911 splice site probably benign
R9723:Pak2 UTSW 16 32033832 missense probably damaging 0.99
Z1177:Pak2 UTSW 16 32044578 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGTTTCTCCACAATACACGGG -3'
(R):5'- ATTGGAACCAGTGAAGTTTGGTAG -3'

Sequencing Primer
(F):5'- GTCCTGGAAATCACTCTGTAGAC -3'
(R):5'- GAGCCCCATGTTAACCTT -3'
Posted On 2016-10-26