Incidental Mutation 'R5586:Synj1'
ID 438770
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Name synaptojanin 1
Synonyms A930006D20Rik
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 90732980-90808196 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to T at 90806865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118522] [ENSMUST00000121759] [ENSMUST00000130813] [ENSMUST00000170853]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023698
SMART Domains Protein: ENSMUSP00000023698
Gene: ENSMUSG00000022974

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 60 86 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 434 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118246
Predicted Effect probably benign
Transcript: ENSMUST00000118390
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118522
SMART Domains Protein: ENSMUSP00000113835
Gene: ENSMUSG00000022974

DomainStartEndE-ValueType
coiled coil region 3 28 N/A INTRINSIC
low complexity region 114 120 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
Pfam:GCFC 597 812 5.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121759
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125902
Predicted Effect probably benign
Transcript: ENSMUST00000130813
SMART Domains Protein: ENSMUSP00000119712
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.4e-86 PFAM
low complexity region 441 459 N/A INTRINSIC
IPPc 526 693 1.8e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156140
Predicted Effect probably benign
Transcript: ENSMUST00000170853
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,277,153 (GRCm39) noncoding transcript Het
Aaas A T 15: 102,255,111 (GRCm39) probably null Het
Abcc3 G A 11: 94,255,247 (GRCm39) R600W probably damaging Het
Abhd13 A T 8: 10,038,318 (GRCm39) Q305L probably benign Het
Adcy5 A T 16: 34,977,486 (GRCm39) I340F probably damaging Het
Adgrl3 T A 5: 81,871,994 (GRCm39) I964N probably damaging Het
Anks1b T A 10: 89,912,926 (GRCm39) H316Q probably damaging Het
Ap3d1 A T 10: 80,554,964 (GRCm39) F454I possibly damaging Het
Apol7c T C 15: 77,410,599 (GRCm39) R116G possibly damaging Het
Arhgap5 A G 12: 52,566,695 (GRCm39) E1222G possibly damaging Het
AW551984 A G 9: 39,502,559 (GRCm39) V673A probably benign Het
Baiap2l1 A G 5: 144,218,949 (GRCm39) S220P probably damaging Het
Bcl6 A G 16: 23,791,926 (GRCm39) F143L probably benign Het
Calb1 A T 4: 15,900,811 (GRCm39) T165S probably benign Het
Ccdc66 C A 14: 27,228,668 (GRCm39) G6C probably damaging Het
Ccdc88a A G 11: 29,453,484 (GRCm39) I344V probably benign Het
Cdh19 T A 1: 110,857,587 (GRCm39) D249V probably damaging Het
Ces1c T A 8: 93,854,227 (GRCm39) T103S probably benign Het
Cfap54 T A 10: 92,808,473 (GRCm39) K1401* probably null Het
Copa T A 1: 171,932,789 (GRCm39) N371K probably damaging Het
Cyp2b10 A T 7: 25,616,437 (GRCm39) Y348F probably damaging Het
Dennd5a T C 7: 109,504,928 (GRCm39) R861G possibly damaging Het
Dhx8 T C 11: 101,623,862 (GRCm39) probably benign Het
Dido1 C T 2: 180,301,445 (GRCm39) W2153* probably null Het
Dlgap1 T A 17: 71,125,156 (GRCm39) V969D probably damaging Het
Dvl3 A G 16: 20,336,039 (GRCm39) D32G probably damaging Het
Epdr1 T C 13: 19,778,718 (GRCm39) D24G probably benign Het
Etnk2 T A 1: 133,307,043 (GRCm39) probably null Het
Fhad1 C T 4: 141,632,442 (GRCm39) M1232I probably benign Het
Gcnt2 A C 13: 41,014,429 (GRCm39) E200A probably damaging Het
Gm5174 A G 10: 86,492,409 (GRCm39) noncoding transcript Het
Gm6408 T A 5: 146,421,267 (GRCm39) F299I possibly damaging Het
Gpr85 G T 6: 13,836,000 (GRCm39) Y301* probably null Het
Gucy2e G T 11: 69,117,082 (GRCm39) P780T probably damaging Het
Icam5 A T 9: 20,946,116 (GRCm39) N316I probably damaging Het
Ifit1bl1 C T 19: 34,571,677 (GRCm39) R260Q probably damaging Het
Il1r1 A C 1: 40,264,411 (GRCm39) probably benign Het
Kif3c A T 12: 3,439,656 (GRCm39) I86F probably benign Het
Klhdc2 A G 12: 69,354,467 (GRCm39) probably null Het
Mast2 A G 4: 116,292,760 (GRCm39) L9P probably damaging Het
Mcoln1 G T 8: 3,560,389 (GRCm39) C316F probably damaging Het
Mon1a A T 9: 107,775,894 (GRCm39) D4V probably damaging Het
Ms4a18 T A 19: 10,991,038 (GRCm39) M19L probably benign Het
Nbea T C 3: 55,539,392 (GRCm39) K2790E probably benign Het
Niban1 C T 1: 151,593,307 (GRCm39) T664I probably benign Het
Noc3l C T 19: 38,803,139 (GRCm39) E167K possibly damaging Het
Nol10 G A 12: 17,466,829 (GRCm39) E570K possibly damaging Het
Nr2e3 T C 9: 59,856,484 (GRCm39) R69G probably damaging Het
Obscn G A 11: 58,892,294 (GRCm39) R1358* probably null Het
Or14j4 A T 17: 37,921,145 (GRCm39) F166I probably damaging Het
Or2b7 C A 13: 21,739,266 (GRCm39) V309F probably damaging Het
Or52e8b A G 7: 104,673,428 (GRCm39) I253T probably damaging Het
Or5b117 A T 19: 13,431,746 (GRCm39) M45K probably benign Het
Pak2 A T 16: 31,860,337 (GRCm39) D175E probably benign Het
Pccb C T 9: 100,867,856 (GRCm39) V357I possibly damaging Het
Pcdhb4 C T 18: 37,442,034 (GRCm39) P448L probably damaging Het
Pcdhb9 A G 18: 37,534,167 (GRCm39) M54V probably benign Het
Ppp3cb A G 14: 20,570,758 (GRCm39) probably benign Het
Ppp4r1 A G 17: 66,131,563 (GRCm39) D452G probably benign Het
Pramel18 T A 4: 101,767,317 (GRCm39) F189I probably benign Het
Prmt3 T A 7: 49,476,499 (GRCm39) D369E probably damaging Het
Psmd12 T A 11: 107,377,301 (GRCm39) V120D probably benign Het
Ptprb T C 10: 116,189,732 (GRCm39) L1797P probably damaging Het
Ptprm A G 17: 67,227,191 (GRCm39) S653P probably damaging Het
Pxdn T A 12: 30,053,141 (GRCm39) V926D probably damaging Het
Retreg3 T G 11: 100,997,165 (GRCm39) Q105P probably damaging Het
Sacs A T 14: 61,443,890 (GRCm39) R1979* probably null Het
Scn2a T A 2: 65,537,639 (GRCm39) L696* probably null Het
Sema3c A T 5: 17,916,422 (GRCm39) N465Y probably damaging Het
Slc25a32 A T 15: 38,963,308 (GRCm39) V171E possibly damaging Het
Slc30a7 C T 3: 115,783,700 (GRCm39) V158I probably benign Het
Slc44a5 G A 3: 153,975,802 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,685,045 (GRCm39) D140G probably damaging Het
Slc7a11 G A 3: 50,397,532 (GRCm39) S60L possibly damaging Het
Spryd3 A T 15: 102,040,372 (GRCm39) H59Q probably benign Het
Sqstm1 T C 11: 50,093,849 (GRCm39) D256G probably damaging Het
Sst A T 16: 23,708,487 (GRCm39) S115T probably damaging Het
Stimate A G 14: 30,592,776 (GRCm39) K166E probably damaging Het
Surf1 T C 2: 26,805,963 (GRCm39) probably benign Het
Tet1 C A 10: 62,714,073 (GRCm39) C574F probably damaging Het
Thnsl1 T A 2: 21,217,201 (GRCm39) Y318* probably null Het
Tomm70a A G 16: 56,942,493 (GRCm39) E90G probably damaging Het
Treml4 A G 17: 48,571,927 (GRCm39) D110G probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl1 C T 18: 63,797,396 (GRCm39) G283D probably damaging Het
Uba6 T C 5: 86,282,906 (GRCm39) D559G probably damaging Het
Usp4 T C 9: 108,233,661 (GRCm39) V94A possibly damaging Het
Vmn2r25 A C 6: 123,802,255 (GRCm39) C549W probably damaging Het
Vmn2r59 G T 7: 41,695,105 (GRCm39) Q436K probably benign Het
Wdr70 A T 15: 7,913,769 (GRCm39) Y627N possibly damaging Het
Xpr1 T C 1: 155,188,609 (GRCm39) I344V probably benign Het
Zfp423 T A 8: 88,585,968 (GRCm39) Q61L possibly damaging Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90,748,864 (GRCm39) missense probably damaging 1.00
IGL01468:Synj1 APN 16 90,807,060 (GRCm39) splice site probably benign
IGL02209:Synj1 APN 16 90,784,307 (GRCm39) missense probably damaging 0.97
IGL02452:Synj1 APN 16 90,758,253 (GRCm39) splice site probably benign
IGL02619:Synj1 APN 16 90,770,933 (GRCm39) missense probably damaging 1.00
IGL02650:Synj1 APN 16 90,773,584 (GRCm39) missense probably benign 0.03
IGL02708:Synj1 APN 16 90,788,350 (GRCm39) missense probably damaging 1.00
IGL02863:Synj1 APN 16 90,758,322 (GRCm39) missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90,785,056 (GRCm39) missense probably damaging 0.99
IGL03295:Synj1 APN 16 90,735,318 (GRCm39) missense probably benign 0.14
IGL03356:Synj1 APN 16 90,784,280 (GRCm39) missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90,761,396 (GRCm39) missense probably damaging 1.00
R0179:Synj1 UTSW 16 90,761,519 (GRCm39) missense possibly damaging 0.80
R0396:Synj1 UTSW 16 90,735,528 (GRCm39) missense probably benign
R0426:Synj1 UTSW 16 90,764,242 (GRCm39) missense probably damaging 1.00
R0486:Synj1 UTSW 16 90,735,151 (GRCm39) utr 3 prime probably benign
R0515:Synj1 UTSW 16 90,790,910 (GRCm39) missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90,744,975 (GRCm39) missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90,757,503 (GRCm39) missense probably benign 0.44
R0698:Synj1 UTSW 16 90,757,503 (GRCm39) missense probably benign 0.44
R0945:Synj1 UTSW 16 90,757,333 (GRCm39) missense possibly damaging 0.90
R1327:Synj1 UTSW 16 90,743,743 (GRCm39) missense probably benign 0.05
R1562:Synj1 UTSW 16 90,784,290 (GRCm39) missense probably benign 0.09
R1732:Synj1 UTSW 16 90,761,118 (GRCm39) missense probably damaging 0.99
R1752:Synj1 UTSW 16 90,735,361 (GRCm39) missense probably benign
R1785:Synj1 UTSW 16 90,761,405 (GRCm39) missense probably damaging 1.00
R1786:Synj1 UTSW 16 90,761,405 (GRCm39) missense probably damaging 1.00
R2011:Synj1 UTSW 16 90,735,584 (GRCm39) missense probably damaging 1.00
R2012:Synj1 UTSW 16 90,735,584 (GRCm39) missense probably damaging 1.00
R2065:Synj1 UTSW 16 90,788,537 (GRCm39) critical splice acceptor site probably null
R2862:Synj1 UTSW 16 90,766,217 (GRCm39) missense probably damaging 1.00
R3026:Synj1 UTSW 16 90,775,622 (GRCm39) missense probably damaging 1.00
R3151:Synj1 UTSW 16 90,757,514 (GRCm39) missense probably damaging 0.96
R3946:Synj1 UTSW 16 90,806,984 (GRCm39) missense possibly damaging 0.48
R3971:Synj1 UTSW 16 90,788,491 (GRCm39) missense probably damaging 1.00
R4472:Synj1 UTSW 16 90,766,069 (GRCm39) critical splice donor site probably null
R4547:Synj1 UTSW 16 90,785,170 (GRCm39) missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90,770,877 (GRCm39) missense probably damaging 1.00
R4739:Synj1 UTSW 16 90,752,307 (GRCm39) missense probably benign 0.00
R5027:Synj1 UTSW 16 90,737,407 (GRCm39) splice site probably null
R5428:Synj1 UTSW 16 90,788,406 (GRCm39) missense probably damaging 0.98
R5769:Synj1 UTSW 16 90,735,141 (GRCm39) utr 3 prime probably benign
R6005:Synj1 UTSW 16 90,766,174 (GRCm39) missense probably damaging 1.00
R6119:Synj1 UTSW 16 90,735,877 (GRCm39) missense probably benign 0.30
R6313:Synj1 UTSW 16 90,743,703 (GRCm39) missense probably benign 0.00
R6324:Synj1 UTSW 16 90,735,518 (GRCm39) missense probably benign 0.00
R6549:Synj1 UTSW 16 90,735,565 (GRCm39) missense probably benign
R6696:Synj1 UTSW 16 90,757,340 (GRCm39) missense probably damaging 0.98
R6698:Synj1 UTSW 16 90,757,340 (GRCm39) missense probably damaging 0.98
R6861:Synj1 UTSW 16 90,760,768 (GRCm39) nonsense probably null
R7008:Synj1 UTSW 16 90,790,833 (GRCm39) missense probably damaging 1.00
R7153:Synj1 UTSW 16 90,744,978 (GRCm39) missense probably benign 0.04
R7393:Synj1 UTSW 16 90,748,887 (GRCm39) missense probably damaging 0.99
R7510:Synj1 UTSW 16 90,735,565 (GRCm39) missense probably benign
R7560:Synj1 UTSW 16 90,737,371 (GRCm39) missense probably benign
R7724:Synj1 UTSW 16 90,758,387 (GRCm39) missense probably damaging 0.99
R7913:Synj1 UTSW 16 90,788,315 (GRCm39) missense possibly damaging 0.83
R8326:Synj1 UTSW 16 90,785,084 (GRCm39) missense probably benign 0.12
R8707:Synj1 UTSW 16 90,752,319 (GRCm39) missense probably benign 0.02
R8711:Synj1 UTSW 16 90,806,971 (GRCm39) missense probably damaging 0.98
R8767:Synj1 UTSW 16 90,758,406 (GRCm39) missense probably damaging 1.00
R8911:Synj1 UTSW 16 90,775,622 (GRCm39) missense probably damaging 1.00
R9052:Synj1 UTSW 16 90,735,728 (GRCm39) missense probably benign 0.00
R9124:Synj1 UTSW 16 90,735,513 (GRCm39) missense probably benign 0.00
R9307:Synj1 UTSW 16 90,785,095 (GRCm39) missense probably damaging 0.98
R9408:Synj1 UTSW 16 90,741,740 (GRCm39) missense probably benign 0.27
R9458:Synj1 UTSW 16 90,766,200 (GRCm39) missense probably benign 0.05
R9567:Synj1 UTSW 16 90,790,912 (GRCm39) missense possibly damaging 0.79
R9651:Synj1 UTSW 16 90,757,343 (GRCm39) missense possibly damaging 0.56
R9651:Synj1 UTSW 16 90,735,412 (GRCm39) missense probably benign 0.00
R9707:Synj1 UTSW 16 90,758,300 (GRCm39) missense possibly damaging 0.91
R9730:Synj1 UTSW 16 90,757,552 (GRCm39) missense probably damaging 0.98
R9732:Synj1 UTSW 16 90,761,414 (GRCm39) missense probably damaging 1.00
Z1176:Synj1 UTSW 16 90,784,228 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGAGATGCAAGCTGTC -3'
(R):5'- ACTTGGTTTCCACAGGGCTG -3'

Sequencing Primer
(F):5'- ACAGGAGATGCAAGCTGTCTTATTG -3'
(R):5'- ACAGGGCTGCCTCTGAAG -3'
Posted On 2016-10-26