Incidental Mutation 'R5587:Ptgs2'
ID438786
Institutional Source Beutler Lab
Gene Symbol Ptgs2
Ensembl Gene ENSMUSG00000032487
Gene Nameprostaglandin-endoperoxide synthase 2
SynonymsCox-2, PHS-2, COX2, prostaglandin G/H synthase, PGHS-2, Pghs2, Tis10, cyclooxygenase 2, cyclooxygenase-2
MMRRC Submission 043141-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R5587 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location150100031-150108227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150105555 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 530 (Y530H)
Ref Sequence ENSEMBL: ENSMUSP00000035065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035065] [ENSMUST00000190784]
PDB Structure CRYSTAL STRUCTURE OF ARACHIDONIC ACID BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION]
CYCLOOXYGENASE-2 (PROSTAGLANDIN SYNTHASE-2) COMPLEXED WITH A SELECTIVE INHIBITOR, SC-558 [X-RAY DIFFRACTION]
[]
[]
CRYSTAL STRUCTURE OF A MIXTURE OF ARACHIDONIC ACID AND PROSTAGLANDIN BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2: PROSTAGLANDIN STRUCTURE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF DICLOFENAC BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION]
X-ray crystal structure of arachidonic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of eicosapentaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of docosahexaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of arachidonic acid bound in the cyclooxygenase channel of L531F murine COX-2 [X-RAY DIFFRACTION]
>> 25 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000035065
AA Change: Y530H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035065
Gene: ENSMUSG00000032487
AA Change: Y530H

DomainStartEndE-ValueType
EGF 20 55 2.64e1 SMART
low complexity region 182 198 N/A INTRINSIC
Pfam:An_peroxidase 206 562 7.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190784
SMART Domains Protein: ENSMUSP00000139904
Gene: ENSMUSG00000032487

DomainStartEndE-ValueType
Blast:EGF 1 23 2e-9 BLAST
SCOP:d1eqga2 1 26 5e-8 SMART
PDB:1CVU|B 1 62 1e-38 PDB
SCOP:d1cvua1 27 62 1e-20 SMART
Meta Mutation Damage Score 0.6259 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: This gene encodes an enzyme that is a member of the prostaglandin G/H synthase family. The encoded protein converts arachidonic acid to prostaglandin endoperoxide H2 which is a key enzymatic step in prostaglandin biosynthesis. This gene is the inducible prostaglandin G/H synthase family member that is upregulated during inflammation. Aberrant regulation of this gene is associated with cancer progression in several tissues and an increased risk of cardiovascular events. This gene is the target of many non-steroidal anti-inflammatory drugs. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit increased perinatal mortality associated with frequent lack of closure and remodeling of the ductus arteriosus, background-sensitive kidney dysplasia with microcyst formation, and myocardial fibrosis. Mutant females show impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,409 R120G probably benign Het
4930548H24Rik G T 5: 31,486,084 G53W probably benign Het
Acad11 A G 9: 104,063,767 T3A probably benign Het
Adamts18 G A 8: 113,775,360 Q290* probably null Het
Ahnak A G 19: 9,009,476 D2708G possibly damaging Het
Asxl3 T A 18: 22,525,247 C2105S probably benign Het
Atp8b1 A T 18: 64,539,210 F1028I probably damaging Het
Axdnd1 C G 1: 156,351,412 W615C probably damaging Het
Bcl3 A T 7: 19,809,634 Y10* probably null Het
Bmp2 T A 2: 133,554,646 V74E possibly damaging Het
Ccdc109b A C 3: 129,916,970 V271G probably benign Het
Ccdc78 C A 17: 25,786,677 P21Q probably benign Het
Cluap1 T A 16: 3,915,484 V199E probably damaging Het
Cntnap3 T C 13: 64,746,738 E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 W1330R unknown Het
Coq4 A G 2: 29,795,514 probably null Het
Cwf19l1 G A 19: 44,120,877 T346I possibly damaging Het
Cyct T C 2: 76,354,203 Y68C probably damaging Het
Dnah10 T C 5: 124,793,913 L2368P probably benign Het
Dnah2 A T 11: 69,437,242 F3346I probably damaging Het
Dpp3 A T 19: 4,918,267 V259E probably damaging Het
Dpyd A C 3: 119,064,951 S605R probably damaging Het
Emc1 A G 4: 139,362,148 E209G probably damaging Het
Esrra A G 19: 6,920,207 S61P probably benign Het
Fam71d C A 12: 78,715,075 P171H probably damaging Het
Gbx2 T A 1: 89,933,122 probably benign Het
Hepacam A G 9: 37,384,684 H377R probably damaging Het
Igkv12-46 T C 6: 69,764,550 Y107C probably damaging Het
Intu A G 3: 40,675,308 D356G probably damaging Het
Izumo4 A T 10: 80,703,220 N113Y probably damaging Het
Krt86 G A 15: 101,473,593 A15T probably benign Het
Lhx8 A T 3: 154,311,679 S275R probably damaging Het
Lingo3 A T 10: 80,835,530 S189T probably damaging Het
Llgl1 T A 11: 60,710,342 M702K probably benign Het
Lpin1 T C 12: 16,573,714 Y223C probably damaging Het
Lrit3 G T 3: 129,788,898 A359E probably benign Het
Lrp2 T C 2: 69,499,263 E1720G probably benign Het
Nktr C T 9: 121,748,489 probably benign Het
Olfr1342 T A 4: 118,689,870 D194V probably damaging Het
Olfr1502 G A 19: 13,862,576 R261H probably damaging Het
Olfr347 A T 2: 36,734,621 Q100L probably damaging Het
Olfr617 T A 7: 103,584,531 Y170N probably benign Het
Olfr979 A T 9: 40,000,621 I202N possibly damaging Het
Olfr984 A T 9: 40,101,244 L82Q probably damaging Het
Pcdha4 T C 18: 36,954,822 V686A probably benign Het
Pelo A G 13: 115,089,873 V16A possibly damaging Het
Plcd1 A G 9: 119,073,832 S539P probably benign Het
Prss1 A G 6: 41,463,265 I179V possibly damaging Het
Rai1 T C 11: 60,189,859 V1583A probably damaging Het
Raph1 T G 1: 60,498,473 D508A probably damaging Het
Rmnd5a A G 6: 71,394,619 probably benign Het
Rsf1 T C 7: 97,662,121 L686P probably benign Het
Samd9l T C 6: 3,373,291 I1323M possibly damaging Het
Scn1a T C 2: 66,273,081 N1934S probably benign Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sh3glb2 A G 2: 30,354,851 probably null Het
Sis A G 3: 72,914,576 I1384T possibly damaging Het
Spata31d1a A C 13: 59,702,618 C565W probably damaging Het
Srbd1 T A 17: 86,127,801 Q278L probably damaging Het
Sry T C Y: 2,662,625 H345R unknown Het
Suox A T 10: 128,671,825 D111E probably damaging Het
Taar7a A T 10: 23,992,828 F218L probably benign Het
Tfcp2l1 C A 1: 118,664,762 N288K possibly damaging Het
Tmem128 G T 5: 38,260,421 R7L possibly damaging Het
Tmem266 A G 9: 55,437,566 N494S probably damaging Het
Tmprss3 T A 17: 31,193,992 H80L probably benign Het
Tnrc6c C T 11: 117,749,271 Q1211* probably null Het
Tns1 T A 1: 73,920,596 D1671V possibly damaging Het
Trmt1l T A 1: 151,435,704 probably benign Het
Tshz2 A T 2: 169,884,342 D286V probably damaging Het
Ttyh2 A G 11: 114,675,659 E39G probably benign Het
Vmn2r125 G A 4: 156,350,138 C73Y probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r61 T C 7: 42,300,487 F777S probably damaging Het
Vmn2r9 T C 5: 108,847,561 E407G probably damaging Het
Vwa3a A G 7: 120,780,235 N521S probably damaging Het
Zan C G 5: 137,391,762 S4816T unknown Het
Zc3h7b T C 15: 81,771,858 Y136H possibly damaging Het
Zfp101 T C 17: 33,381,321 K487R possibly damaging Het
Other mutations in Ptgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Ptgs2 APN 1 150104424 missense probably damaging 1.00
IGL01626:Ptgs2 APN 1 150103727 missense probably damaging 1.00
IGL01758:Ptgs2 APN 1 150101989 critical splice acceptor site probably null
IGL02168:Ptgs2 APN 1 150103679 splice site probably null
IGL02309:Ptgs2 APN 1 150105556 missense probably damaging 1.00
IGL02363:Ptgs2 APN 1 150105709 splice site probably null
IGL02574:Ptgs2 APN 1 150102775 nonsense probably null
IGL03156:Ptgs2 APN 1 150105477 missense probably damaging 1.00
R0436:Ptgs2 UTSW 1 150104277 unclassified probably benign
R0629:Ptgs2 UTSW 1 150101037 missense probably benign
R0631:Ptgs2 UTSW 1 150104537 missense probably benign 0.30
R0811:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0812:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0980:Ptgs2 UTSW 1 150104310 missense probably damaging 1.00
R1340:Ptgs2 UTSW 1 150105477 missense probably damaging 1.00
R1626:Ptgs2 UTSW 1 150103868 critical splice acceptor site probably null
R1666:Ptgs2 UTSW 1 150101270 missense probably damaging 1.00
R1742:Ptgs2 UTSW 1 150104399 missense probably damaging 1.00
R1926:Ptgs2 UTSW 1 150100228 missense possibly damaging 0.48
R2148:Ptgs2 UTSW 1 150105714 missense probably benign
R2361:Ptgs2 UTSW 1 150103975 missense probably benign 0.00
R2927:Ptgs2 UTSW 1 150101260 missense possibly damaging 0.95
R3966:Ptgs2 UTSW 1 150105475 missense probably damaging 0.99
R4291:Ptgs2 UTSW 1 150100251 missense probably benign
R4580:Ptgs2 UTSW 1 150104094 missense possibly damaging 0.78
R4668:Ptgs2 UTSW 1 150101084 missense probably benign 0.32
R4751:Ptgs2 UTSW 1 150104020 missense probably damaging 1.00
R4777:Ptgs2 UTSW 1 150105387 missense probably benign 0.03
R5264:Ptgs2 UTSW 1 150102730 missense possibly damaging 0.62
R5570:Ptgs2 UTSW 1 150104108 missense probably damaging 1.00
R5761:Ptgs2 UTSW 1 150105528 missense probably benign 0.18
R5850:Ptgs2 UTSW 1 150105376 missense probably benign 0.03
R6137:Ptgs2 UTSW 1 150100993 missense probably benign 0.08
R6513:Ptgs2 UTSW 1 150100128 unclassified probably benign
R6553:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6585:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6593:Ptgs2 UTSW 1 150101033 missense possibly damaging 0.63
R6772:Ptgs2 UTSW 1 150102078 missense probably damaging 1.00
R6850:Ptgs2 UTSW 1 150105540 missense probably damaging 1.00
R7205:Ptgs2 UTSW 1 150102761 missense probably benign 0.01
R7320:Ptgs2 UTSW 1 150102695 missense probably damaging 1.00
R7567:Ptgs2 UTSW 1 150102697 missense probably damaging 0.99
R7751:Ptgs2 UTSW 1 150104507 missense probably benign 0.14
R7863:Ptgs2 UTSW 1 150101339 missense probably damaging 1.00
R8100:Ptgs2 UTSW 1 150102721 missense probably damaging 1.00
R8117:Ptgs2 UTSW 1 150104034 missense probably damaging 1.00
R8128:Ptgs2 UTSW 1 150101348 missense probably damaging 0.99
Z1176:Ptgs2 UTSW 1 150105721 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGCAGAATTGAAAGCCC -3'
(R):5'- CTTTTACAGCTCAGTTGAACGC -3'

Sequencing Primer
(F):5'- GCCCTCTACAGTGACATCGATG -3'
(R):5'- ACAGCTCAGTTGAACGCCTTTTG -3'
Posted On2016-10-26