Incidental Mutation 'R5587:Lrp2'
ID 438794
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Name low density lipoprotein receptor-related protein 2
Synonyms Gp330, D230004K18Rik, b2b1625.2Clo, Megalin
MMRRC Submission 043141-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5587 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69424340-69586065 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69499263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1720 (E1720G)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080953
AA Change: E1720G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: E1720G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,409 R120G probably benign Het
4930548H24Rik G T 5: 31,486,084 G53W probably benign Het
Acad11 A G 9: 104,063,767 T3A probably benign Het
Adamts18 G A 8: 113,775,360 Q290* probably null Het
Ahnak A G 19: 9,009,476 D2708G possibly damaging Het
Asxl3 T A 18: 22,525,247 C2105S probably benign Het
Atp8b1 A T 18: 64,539,210 F1028I probably damaging Het
Axdnd1 C G 1: 156,351,412 W615C probably damaging Het
Bcl3 A T 7: 19,809,634 Y10* probably null Het
Bmp2 T A 2: 133,554,646 V74E possibly damaging Het
Ccdc78 C A 17: 25,786,677 P21Q probably benign Het
Cluap1 T A 16: 3,915,484 V199E probably damaging Het
Cntnap3 T C 13: 64,746,738 E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 W1330R unknown Het
Coq4 A G 2: 29,795,514 probably null Het
Cwf19l1 G A 19: 44,120,877 T346I possibly damaging Het
Cyct T C 2: 76,354,203 Y68C probably damaging Het
Dnah10 T C 5: 124,793,913 L2368P probably benign Het
Dnah2 A T 11: 69,437,242 F3346I probably damaging Het
Dpp3 A T 19: 4,918,267 V259E probably damaging Het
Dpyd A C 3: 119,064,951 S605R probably damaging Het
Emc1 A G 4: 139,362,148 E209G probably damaging Het
Esrra A G 19: 6,920,207 S61P probably benign Het
Fam71d C A 12: 78,715,075 P171H probably damaging Het
Gbx2 T A 1: 89,933,122 probably benign Het
Hepacam A G 9: 37,384,684 H377R probably damaging Het
Igkv12-46 T C 6: 69,764,550 Y107C probably damaging Het
Intu A G 3: 40,675,308 D356G probably damaging Het
Izumo4 A T 10: 80,703,220 N113Y probably damaging Het
Krt86 G A 15: 101,473,593 A15T probably benign Het
Lhx8 A T 3: 154,311,679 S275R probably damaging Het
Lingo3 A T 10: 80,835,530 S189T probably damaging Het
Llgl1 T A 11: 60,710,342 M702K probably benign Het
Lpin1 T C 12: 16,573,714 Y223C Het
Lrit3 G T 3: 129,788,898 A359E probably benign Het
Mcub A C 3: 129,916,970 V271G probably benign Het
Nktr C T 9: 121,748,489 probably benign Het
Olfr1342 T A 4: 118,689,870 D194V probably damaging Het
Olfr1502 G A 19: 13,862,576 R261H probably damaging Het
Olfr347 A T 2: 36,734,621 Q100L probably damaging Het
Olfr617 T A 7: 103,584,531 Y170N probably benign Het
Olfr979 A T 9: 40,000,621 I202N possibly damaging Het
Olfr984 A T 9: 40,101,244 L82Q probably damaging Het
Pcdha4 T C 18: 36,954,822 V686A probably benign Het
Pelo A G 13: 115,089,873 V16A possibly damaging Het
Plcd1 A G 9: 119,073,832 S539P probably benign Het
Prss1 A G 6: 41,463,265 I179V possibly damaging Het
Ptgs2 T C 1: 150,105,555 Y530H probably damaging Het
Rai1 T C 11: 60,189,859 V1583A probably damaging Het
Raph1 T G 1: 60,498,473 D508A probably damaging Het
Rmnd5a A G 6: 71,394,619 probably benign Het
Rsf1 T C 7: 97,662,121 L686P probably benign Het
Samd9l T C 6: 3,373,291 I1323M possibly damaging Het
Scn1a T C 2: 66,273,081 N1934S probably benign Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sh3glb2 A G 2: 30,354,851 probably null Het
Sis A G 3: 72,914,576 I1384T possibly damaging Het
Spata31d1a A C 13: 59,702,618 C565W probably damaging Het
Srbd1 T A 17: 86,127,801 Q278L probably damaging Het
Sry T C Y: 2,662,625 H345R unknown Het
Suox A T 10: 128,671,825 D111E probably damaging Het
Taar7a A T 10: 23,992,828 F218L probably benign Het
Tfcp2l1 C A 1: 118,664,762 N288K possibly damaging Het
Tmem128 G T 5: 38,260,421 R7L possibly damaging Het
Tmem266 A G 9: 55,437,566 N494S probably damaging Het
Tmprss3 T A 17: 31,193,992 H80L probably benign Het
Tnrc6c C T 11: 117,749,271 Q1211* probably null Het
Tns1 T A 1: 73,920,596 D1671V possibly damaging Het
Trmt1l T A 1: 151,435,704 probably benign Het
Tshz2 A T 2: 169,884,342 D286V probably damaging Het
Ttyh2 A G 11: 114,675,659 E39G probably benign Het
Vmn2r125 G A 4: 156,350,138 C73Y probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r61 T C 7: 42,300,487 F777S probably damaging Het
Vmn2r9 T C 5: 108,847,561 E407G probably damaging Het
Vwa3a A G 7: 120,780,235 N521S probably damaging Het
Zan C G 5: 137,391,762 S4816T unknown Het
Zc3h7b T C 15: 81,771,858 Y136H possibly damaging Het
Zfp101 T C 17: 33,381,321 K487R possibly damaging Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69507779 missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69486280 missense probably benign 0.00
IGL00782:Lrp2 APN 2 69501645 missense probably benign 0.14
IGL00821:Lrp2 APN 2 69459516 missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69521881 missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69469436 missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69524073 missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69492432 nonsense probably null
IGL01131:Lrp2 APN 2 69499239 missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69510984 missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69503526 missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69552470 splice site probably benign
IGL01375:Lrp2 APN 2 69478566 splice site probably benign
IGL01384:Lrp2 APN 2 69483502 missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69453812 missense probably null 1.00
IGL01411:Lrp2 APN 2 69482267 missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69525286 missense probably benign
IGL01444:Lrp2 APN 2 69443716 missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69472439 missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69492460 missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69428706 missense probably benign
IGL01761:Lrp2 APN 2 69481235 missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69486184 missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69483601 missense probably benign 0.08
IGL02015:Lrp2 APN 2 69527578 missense probably benign 0.00
IGL02104:Lrp2 APN 2 69510418 missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69537616 missense probably benign 0.01
IGL02134:Lrp2 APN 2 69513379 critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69466880 missense probably benign 0.01
IGL02212:Lrp2 APN 2 69451264 missense probably benign 0.00
IGL02240:Lrp2 APN 2 69535046 missense probably benign
IGL02248:Lrp2 APN 2 69482808 missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69464636 missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69469633 missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69461305 missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69521773 missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69464801 splice site probably benign
IGL02508:Lrp2 APN 2 69503430 missense probably benign 0.04
IGL02751:Lrp2 APN 2 69533462 missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69506736 missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69455510 missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69487837 missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69455453 splice site probably benign
IGL02990:Lrp2 APN 2 69441396 missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69537553 missense probably benign 0.43
IGL03038:Lrp2 APN 2 69475464 missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69483133 missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69454833 missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69477026 missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69549042 missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69455452 splice site probably benign
IGL03163:Lrp2 APN 2 69501526 nonsense probably null
IGL03164:Lrp2 APN 2 69464699 missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69523194 missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69466265 missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69438478 splice site probably benign
IGL03288:Lrp2 APN 2 69426039 missense probably benign 0.02
IGL03350:Lrp2 APN 2 69438453 missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69431152 missense probably damaging 1.00
casual UTSW 2 69499263 missense probably benign
nonchalant UTSW 2 69489329 missense probably damaging 1.00
Presto UTSW 2 69459531 nonsense probably null
relaxed UTSW 2 69535005 missense probably damaging 1.00
unguarded UTSW 2 69465758 missense probably benign 0.00
Unintended UTSW 2 69518443 missense probably damaging 1.00
BB009:Lrp2 UTSW 2 69426027 missense probably benign 0.00
BB019:Lrp2 UTSW 2 69426027 missense probably benign 0.00
IGL02835:Lrp2 UTSW 2 69505304 missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69458448 missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69537538 missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69475403 missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0044:Lrp2 UTSW 2 69527555 missense probably benign 0.01
R0044:Lrp2 UTSW 2 69527555 missense probably damaging 0.96
R0048:Lrp2 UTSW 2 69465627 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69477040 missense probably benign
R0167:Lrp2 UTSW 2 69425658 missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69537563 missense probably null 1.00
R0243:Lrp2 UTSW 2 69428630 missense probably benign 0.00
R0308:Lrp2 UTSW 2 69482982 splice site probably benign
R0323:Lrp2 UTSW 2 69469639 missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69535043 missense probably benign 0.10
R0374:Lrp2 UTSW 2 69430307 missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69456858 missense probably damaging 0.99
R0391:Lrp2 UTSW 2 69460337 splice site probably benign
R0395:Lrp2 UTSW 2 69433077 missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69479148 missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69525234 missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69507801 missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69511017 missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69428654 missense probably benign 0.00
R0544:Lrp2 UTSW 2 69491931 missense probably benign 0.18
R0548:Lrp2 UTSW 2 69537638 splice site probably benign
R0593:Lrp2 UTSW 2 69467006 missense probably benign
R0608:Lrp2 UTSW 2 69486243 missense probably benign 0.02
R0633:Lrp2 UTSW 2 69448120 missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69451380 missense probably benign 0.19
R0718:Lrp2 UTSW 2 69510948 missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69448169 missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69507990 missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69518365 missense probably benign 0.32
R0885:Lrp2 UTSW 2 69482353 missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69487838 missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69524036 missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69523302 splice site probably null
R1301:Lrp2 UTSW 2 69428604 missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69456918 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69460477 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69483394 missense probably damaging 0.99
R1529:Lrp2 UTSW 2 69523182 missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69500730 missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69502610 missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69502661 missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69466763 critical splice donor site probably null
R1689:Lrp2 UTSW 2 69503529 missense probably benign 0.09
R1693:Lrp2 UTSW 2 69510418 missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69496489 missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69503530 missense probably benign 0.04
R1834:Lrp2 UTSW 2 69466880 missense probably benign 0.01
R1921:Lrp2 UTSW 2 69523287 missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69467090 missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69507843 missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2093:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2108:Lrp2 UTSW 2 69506624 missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69483385 missense probably benign 0.05
R2122:Lrp2 UTSW 2 69483707 missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69511067 missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69467028 missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69511010 missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69491847 missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69506374 splice site probably null
R2984:Lrp2 UTSW 2 69425814 splice site probably null
R3085:Lrp2 UTSW 2 69467135 missense probably benign 0.05
R3103:Lrp2 UTSW 2 69431984 missense probably benign 0.00
R3727:Lrp2 UTSW 2 69510429 missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3731:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3764:Lrp2 UTSW 2 69496336 missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69505105 missense probably benign 0.34
R3778:Lrp2 UTSW 2 69509204 missense probably benign 0.00
R3808:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69426012 missense probably benign 0.03
R3852:Lrp2 UTSW 2 69537565 missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69459472 critical splice donor site probably null
R3877:Lrp2 UTSW 2 69549047 missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69506376 missense probably benign
R4081:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69430262 critical splice donor site probably null
R4193:Lrp2 UTSW 2 69467143 missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69480094 missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69425991 nonsense probably null
R4352:Lrp2 UTSW 2 69432182 critical splice donor site probably null
R4407:Lrp2 UTSW 2 69502517 missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69467169 missense probably benign 0.09
R4416:Lrp2 UTSW 2 69527231 missense probably benign 0.18
R4426:Lrp2 UTSW 2 69506348 missense probably benign 0.00
R4510:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69513285 missense probably benign 0.13
R4591:Lrp2 UTSW 2 69536075 missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69458427 nonsense probably null
R4622:Lrp2 UTSW 2 69460349 missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69489129 splice site probably null
R4633:Lrp2 UTSW 2 69461417 missense probably benign 0.16
R4636:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69466993 missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69489298 missense probably benign 0.02
R4712:Lrp2 UTSW 2 69506551 missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69487966 missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69481173 missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69533555 missense probably benign
R4733:Lrp2 UTSW 2 69533555 missense probably benign
R4777:Lrp2 UTSW 2 69482264 missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69459715 missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69537956 missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69469411 missense probably benign 0.06
R4845:Lrp2 UTSW 2 69509241 missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69479113 missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69472368 missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69535988 missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69481388 missense probably benign 0.01
R5075:Lrp2 UTSW 2 69465758 missense probably benign 0.00
R5078:Lrp2 UTSW 2 69501530 missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69489158 missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69501490 missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69430342 missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69552349 splice site probably null
R5223:Lrp2 UTSW 2 69524053 missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69456819 splice site probably null
R5267:Lrp2 UTSW 2 69548978 missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69513354 missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69525228 missense probably benign 0.01
R5355:Lrp2 UTSW 2 69454838 nonsense probably null
R5356:Lrp2 UTSW 2 69464708 missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69459560 missense probably benign 0.04
R5486:Lrp2 UTSW 2 69437465 missense probably benign 0.04
R5554:Lrp2 UTSW 2 69552424 missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69451288 missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69464624 missense possibly damaging 0.77
R5605:Lrp2 UTSW 2 69523299 missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69472418 missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69519914 missense probably null 0.80
R5686:Lrp2 UTSW 2 69511061 missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69502553 missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69451382 missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69509147 missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69466877 missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69455525 missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69480153 missense probably benign 0.00
R5892:Lrp2 UTSW 2 69442776 missense probably benign
R5951:Lrp2 UTSW 2 69496323 splice site probably null
R5974:Lrp2 UTSW 2 69459548 missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69535005 missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69506754 missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69483557 missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69511001 missense probably benign 0.00
R6177:Lrp2 UTSW 2 69510419 frame shift probably null
R6180:Lrp2 UTSW 2 69503524 missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69469478 missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69466340 missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69436681 missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69438467 missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69483443 missense probably benign 0.02
R6385:Lrp2 UTSW 2 69495784 missense probably benign 0.22
R6429:Lrp2 UTSW 2 69461287 missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69505156 missense probably benign 0.00
R6524:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69509303 missense probably benign 0.00
R6594:Lrp2 UTSW 2 69439923 missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69469405 missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69453858 missense probably benign 0.01
R6718:Lrp2 UTSW 2 69483780 missense probably benign 0.09
R6736:Lrp2 UTSW 2 69448211 missense probably benign 0.02
R6738:Lrp2 UTSW 2 69458488 missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69483904 missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69518443 missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69513268 missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69513377 missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69524141 missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69510502 missense probably benign
R6902:Lrp2 UTSW 2 69459503 missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69472365 missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69489305 missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69472455 missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69483208 missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69483028 missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69521787 missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69465745 missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69454808 critical splice donor site probably null
R7150:Lrp2 UTSW 2 69488051 missense probably damaging 0.99
R7165:Lrp2 UTSW 2 69506573 missense probably damaging 0.99
R7174:Lrp2 UTSW 2 69433072 missense probably benign 0.11
R7204:Lrp2 UTSW 2 69472533 missense probably benign 0.25
R7275:Lrp2 UTSW 2 69459531 nonsense probably null
R7278:Lrp2 UTSW 2 69486352 missense probably damaging 1.00
R7296:Lrp2 UTSW 2 69482381 missense probably benign 0.04
R7315:Lrp2 UTSW 2 69491822 missense probably damaging 0.98
R7342:Lrp2 UTSW 2 69479290 missense possibly damaging 0.95
R7351:Lrp2 UTSW 2 69448142 missense probably damaging 1.00
R7352:Lrp2 UTSW 2 69472397 missense probably benign 0.04
R7366:Lrp2 UTSW 2 69483806 missense probably damaging 1.00
R7373:Lrp2 UTSW 2 69500692 missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69432213 missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69459674 missense probably damaging 0.99
R7451:Lrp2 UTSW 2 69513333 missense probably damaging 1.00
R7492:Lrp2 UTSW 2 69537581 missense probably damaging 0.99
R7571:Lrp2 UTSW 2 69516403 missense probably damaging 1.00
R7638:Lrp2 UTSW 2 69477008 critical splice donor site probably null
R7664:Lrp2 UTSW 2 69506732 missense probably damaging 1.00
R7686:Lrp2 UTSW 2 69489237 missense probably damaging 1.00
R7711:Lrp2 UTSW 2 69479343 critical splice acceptor site probably null
R7737:Lrp2 UTSW 2 69496438 missense possibly damaging 0.77
R7763:Lrp2 UTSW 2 69503388 missense probably damaging 0.99
R7775:Lrp2 UTSW 2 69501539 missense possibly damaging 0.74
R7824:Lrp2 UTSW 2 69501539 missense possibly damaging 0.74
R7840:Lrp2 UTSW 2 69464784 missense probably damaging 0.98
R7878:Lrp2 UTSW 2 69507809 missense probably damaging 1.00
R7878:Lrp2 UTSW 2 69507810 missense probably damaging 1.00
R7895:Lrp2 UTSW 2 69458479 missense probably damaging 0.97
R7898:Lrp2 UTSW 2 69441366 missense probably benign 0.00
R7912:Lrp2 UTSW 2 69428672 missense probably benign 0.03
R7923:Lrp2 UTSW 2 69438388 missense possibly damaging 0.75
R7932:Lrp2 UTSW 2 69426027 missense probably benign 0.00
R7940:Lrp2 UTSW 2 69432197 missense possibly damaging 0.91
R7954:Lrp2 UTSW 2 69503523 missense possibly damaging 0.61
R8007:Lrp2 UTSW 2 69506505 missense probably benign 0.02
R8084:Lrp2 UTSW 2 69509369 missense probably damaging 0.97
R8087:Lrp2 UTSW 2 69448129 missense probably damaging 1.00
R8090:Lrp2 UTSW 2 69464745 missense possibly damaging 0.94
R8110:Lrp2 UTSW 2 69506453 missense probably benign
R8129:Lrp2 UTSW 2 69430280 missense possibly damaging 0.75
R8155:Lrp2 UTSW 2 69482998 missense possibly damaging 0.74
R8182:Lrp2 UTSW 2 69489329 missense probably damaging 1.00
R8239:Lrp2 UTSW 2 69481267 nonsense probably null
R8247:Lrp2 UTSW 2 69431087 missense possibly damaging 0.76
R8327:Lrp2 UTSW 2 69491924 missense probably damaging 1.00
R8355:Lrp2 UTSW 2 69516484 missense probably damaging 0.99
R8404:Lrp2 UTSW 2 69514241 nonsense probably null
R8427:Lrp2 UTSW 2 69451297 missense probably damaging 0.97
R8463:Lrp2 UTSW 2 69491906 missense probably damaging 1.00
R8502:Lrp2 UTSW 2 69514241 nonsense probably null
R8529:Lrp2 UTSW 2 69500642 missense probably damaging 0.96
R8673:Lrp2 UTSW 2 69472460 missense probably damaging 1.00
R8698:Lrp2 UTSW 2 69448239 missense probably benign 0.39
R8698:Lrp2 UTSW 2 69458423 missense probably benign 0.37
R8708:Lrp2 UTSW 2 69459613 missense probably damaging 1.00
R8716:Lrp2 UTSW 2 69443794 missense probably benign 0.04
R8723:Lrp2 UTSW 2 69486304 missense probably damaging 1.00
R8787:Lrp2 UTSW 2 69552401 missense probably damaging 1.00
R8903:Lrp2 UTSW 2 69549038 missense possibly damaging 0.68
R8944:Lrp2 UTSW 2 69511004 missense probably damaging 1.00
R9069:Lrp2 UTSW 2 69501652 missense probably damaging 1.00
R9076:Lrp2 UTSW 2 69519916 missense probably benign 0.01
R9155:Lrp2 UTSW 2 69461369 nonsense probably null
R9173:Lrp2 UTSW 2 69469387 missense probably damaging 1.00
R9254:Lrp2 UTSW 2 69503547 missense probably benign 0.09
R9256:Lrp2 UTSW 2 69510959 missense probably benign 0.03
R9291:Lrp2 UTSW 2 69480035 missense probably damaging 1.00
R9335:Lrp2 UTSW 2 69428639 missense probably benign 0.01
R9357:Lrp2 UTSW 2 69506573 missense probably damaging 0.99
R9368:Lrp2 UTSW 2 69527635 missense probably damaging 0.99
R9453:Lrp2 UTSW 2 69458488 missense probably damaging 1.00
R9546:Lrp2 UTSW 2 69456821 critical splice donor site probably null
R9554:Lrp2 UTSW 2 69431153 missense probably damaging 1.00
R9597:Lrp2 UTSW 2 69430359 missense probably benign 0.02
R9601:Lrp2 UTSW 2 69459584 missense probably damaging 1.00
R9623:Lrp2 UTSW 2 69477079 missense probably benign 0.09
RF016:Lrp2 UTSW 2 69509205 missense probably benign
X0011:Lrp2 UTSW 2 69519998 missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69436600 missense probably damaging 0.99
Z1176:Lrp2 UTSW 2 69480042 missense possibly damaging 0.66
Z1176:Lrp2 UTSW 2 69507881 missense possibly damaging 0.88
Z1177:Lrp2 UTSW 2 69451280 missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69472453 missense probably benign 0.03
Z1177:Lrp2 UTSW 2 69496468 missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69501641 missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69509289 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTATGTGACAACTGAGGC -3'
(R):5'- GTAACTGCAAGCATTCCCCTTTG -3'

Sequencing Primer
(F):5'- TTGGAGTATACCCACTGAACAACGTG -3'
(R):5'- CCCTTTGCAACAATAGGAGCTGTG -3'
Posted On 2016-10-26