Incidental Mutation 'R5587:Emc1'
ID 438805
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 043141-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R5587 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139089459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 209 (E209G)
Ref Sequence ENSEMBL: ENSMUSP00000152874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect possibly damaging
Transcript: ENSMUST00000042096
AA Change: E382G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: E382G

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082262
AA Change: E382G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: E382G

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155700
AA Change: E209G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: E382G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: E382G

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Meta Mutation Damage Score 0.3862 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,771,170 (GRCm39) R120G probably benign Het
Acad11 A G 9: 103,940,966 (GRCm39) T3A probably benign Het
Adamts18 G A 8: 114,501,992 (GRCm39) Q290* probably null Het
Ahnak A G 19: 8,986,840 (GRCm39) D2708G possibly damaging Het
Asxl3 T A 18: 22,658,304 (GRCm39) C2105S probably benign Het
Atp8b1 A T 18: 64,672,281 (GRCm39) F1028I probably damaging Het
Axdnd1 C G 1: 156,178,982 (GRCm39) W615C probably damaging Het
Bcl3 A T 7: 19,543,559 (GRCm39) Y10* probably null Het
Bmp2 T A 2: 133,396,566 (GRCm39) V74E possibly damaging Het
Ccdc121 G T 5: 31,643,428 (GRCm39) G53W probably benign Het
Ccdc78 C A 17: 26,005,651 (GRCm39) P21Q probably benign Het
Cluap1 T A 16: 3,733,348 (GRCm39) V199E probably damaging Het
Cntnap3 T C 13: 64,894,552 (GRCm39) E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 (GRCm39) W1330R unknown Het
Coq4 A G 2: 29,685,526 (GRCm39) probably null Het
Cwf19l1 G A 19: 44,109,316 (GRCm39) T346I possibly damaging Het
Cyct T C 2: 76,184,547 (GRCm39) Y68C probably damaging Het
Dnah10 T C 5: 124,870,977 (GRCm39) L2368P probably benign Het
Dnah2 A T 11: 69,328,068 (GRCm39) F3346I probably damaging Het
Dpp3 A T 19: 4,968,295 (GRCm39) V259E probably damaging Het
Dpyd A C 3: 118,858,600 (GRCm39) S605R probably damaging Het
Esrra A G 19: 6,897,575 (GRCm39) S61P probably benign Het
Garin2 C A 12: 78,761,849 (GRCm39) P171H probably damaging Het
Gbx2 T A 1: 89,860,844 (GRCm39) probably benign Het
Hepacam A G 9: 37,295,980 (GRCm39) H377R probably damaging Het
Igkv12-46 T C 6: 69,741,534 (GRCm39) Y107C probably damaging Het
Intu A G 3: 40,629,738 (GRCm39) D356G probably damaging Het
Izumo4 A T 10: 80,539,054 (GRCm39) N113Y probably damaging Het
Krt86 G A 15: 101,371,474 (GRCm39) A15T probably benign Het
Lhx8 A T 3: 154,017,316 (GRCm39) S275R probably damaging Het
Lingo3 A T 10: 80,671,364 (GRCm39) S189T probably damaging Het
Llgl1 T A 11: 60,601,168 (GRCm39) M702K probably benign Het
Lpin1 T C 12: 16,623,715 (GRCm39) Y223C Het
Lrit3 G T 3: 129,582,547 (GRCm39) A359E probably benign Het
Lrp2 T C 2: 69,329,607 (GRCm39) E1720G probably benign Het
Mcub A C 3: 129,710,619 (GRCm39) V271G probably benign Het
Nktr C T 9: 121,577,555 (GRCm39) probably benign Het
Or10g9 A T 9: 39,911,917 (GRCm39) I202N possibly damaging Het
Or13p4 T A 4: 118,547,067 (GRCm39) D194V probably damaging Het
Or1j18 A T 2: 36,624,633 (GRCm39) Q100L probably damaging Het
Or4d5 A T 9: 40,012,540 (GRCm39) L82Q probably damaging Het
Or52z12 T A 7: 103,233,738 (GRCm39) Y170N probably benign Het
Or9i1 G A 19: 13,839,940 (GRCm39) R261H probably damaging Het
Pcdha4 T C 18: 37,087,875 (GRCm39) V686A probably benign Het
Pelo A G 13: 115,226,409 (GRCm39) V16A possibly damaging Het
Plcd1 A G 9: 118,902,900 (GRCm39) S539P probably benign Het
Prss1 A G 6: 41,440,199 (GRCm39) I179V possibly damaging Het
Ptgs2 T C 1: 149,981,306 (GRCm39) Y530H probably damaging Het
Rai1 T C 11: 60,080,685 (GRCm39) V1583A probably damaging Het
Raph1 T G 1: 60,537,632 (GRCm39) D508A probably damaging Het
Rmnd5a A G 6: 71,371,603 (GRCm39) probably benign Het
Rsf1 T C 7: 97,311,328 (GRCm39) L686P probably benign Het
Samd9l T C 6: 3,373,291 (GRCm39) I1323M possibly damaging Het
Scn1a T C 2: 66,103,425 (GRCm39) N1934S probably benign Het
Sec23ip C T 7: 128,352,151 (GRCm39) H176Y probably benign Het
Sh3glb2 A G 2: 30,244,863 (GRCm39) probably null Het
Sis A G 3: 72,821,909 (GRCm39) I1384T possibly damaging Het
Spata31d1a A C 13: 59,850,432 (GRCm39) C565W probably damaging Het
Srbd1 T A 17: 86,435,229 (GRCm39) Q278L probably damaging Het
Sry T C Y: 2,662,625 (GRCm39) H345R unknown Het
Suox A T 10: 128,507,694 (GRCm39) D111E probably damaging Het
Taar7a A T 10: 23,868,726 (GRCm39) F218L probably benign Het
Tfcp2l1 C A 1: 118,592,492 (GRCm39) N288K possibly damaging Het
Tmem128 G T 5: 38,417,765 (GRCm39) R7L possibly damaging Het
Tmem266 A G 9: 55,344,850 (GRCm39) N494S probably damaging Het
Tmprss3 T A 17: 31,412,966 (GRCm39) H80L probably benign Het
Tnrc6c C T 11: 117,640,097 (GRCm39) Q1211* probably null Het
Tns1 T A 1: 73,959,755 (GRCm39) D1671V possibly damaging Het
Trmt1l T A 1: 151,311,455 (GRCm39) probably benign Het
Tshz2 A T 2: 169,726,262 (GRCm39) D286V probably damaging Het
Ttyh2 A G 11: 114,566,485 (GRCm39) E39G probably benign Het
Vmn2r125 G A 4: 156,702,433 (GRCm39) C73Y probably damaging Het
Vmn2r5 T C 3: 64,411,497 (GRCm39) D357G probably damaging Het
Vmn2r61 T C 7: 41,949,911 (GRCm39) F777S probably damaging Het
Vmn2r9 T C 5: 108,995,427 (GRCm39) E407G probably damaging Het
Vwa3a A G 7: 120,379,458 (GRCm39) N521S probably damaging Het
Zan C G 5: 137,390,024 (GRCm39) S4816T unknown Het
Zc3h7b T C 15: 81,656,059 (GRCm39) Y136H possibly damaging Het
Zfp101 T C 17: 33,600,295 (GRCm39) K487R possibly damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139,093,841 (GRCm39) missense probably benign 0.08
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139,102,476 (GRCm39) nonsense probably null
R5033:Emc1 UTSW 4 139,099,007 (GRCm39) missense probably damaging 1.00
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R5938:Emc1 UTSW 4 139,084,931 (GRCm39) missense probably benign
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6208:Emc1 UTSW 4 139,081,582 (GRCm39) missense probably damaging 0.99
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R7984:Emc1 UTSW 4 139,102,760 (GRCm39) missense probably damaging 1.00
R8112:Emc1 UTSW 4 139,094,498 (GRCm39) missense probably benign 0.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R8751:Emc1 UTSW 4 139,097,279 (GRCm39) missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CTCCCTTCTCAGATGCACAGTAG -3'
(R):5'- TAGCTCTGGAGGAACTAGGG -3'

Sequencing Primer
(F):5'- CAGCAACTTGTTTCTGCTGTAGGC -3'
(R):5'- GGCCTGTTCAGAGAGCCCTAATC -3'
Posted On 2016-10-26