Mutagenetix > Incidental Mutation

Incidental Mutation 'R5587:Samd9l'

438811

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

043141-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5587 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3373291 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 1323 (I1323M)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120087
AA Change: I1323M

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: I1323M

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

96% (78/81)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,065,409	R120G	probably benign	Het
4930548H24Rik	G	T	5: 31,486,084	G53W	probably benign	Het
Acad11	A	G	9: 104,063,767	T3A	probably benign	Het
Adamts18	G	A	8: 113,775,360	Q290*	probably null	Het
Ahnak	A	G	19: 9,009,476	D2708G	possibly damaging	Het
Asxl3	T	A	18: 22,525,247	C2105S	probably benign	Het
Atp8b1	A	T	18: 64,539,210	F1028I	probably damaging	Het
Axdnd1	C	G	1: 156,351,412	W615C	probably damaging	Het
Bcl3	A	T	7: 19,809,634	Y10*	probably null	Het
Bmp2	T	A	2: 133,554,646	V74E	possibly damaging	Het
Ccdc78	C	A	17: 25,786,677	P21Q	probably benign	Het
Cluap1	T	A	16: 3,915,484	V199E	probably damaging	Het
Cntnap3	T	C	13: 64,746,738	E1120G	probably damaging	Het
Col1a2	T	A	6: 4,540,531	W1330R	unknown	Het
Coq4	A	G	2: 29,795,514		probably null	Het
Cwf19l1	G	A	19: 44,120,877	T346I	possibly damaging	Het
Cyct	T	C	2: 76,354,203	Y68C	probably damaging	Het
Dnah10	T	C	5: 124,793,913	L2368P	probably benign	Het
Dnah2	A	T	11: 69,437,242	F3346I	probably damaging	Het
Dpp3	A	T	19: 4,918,267	V259E	probably damaging	Het
Dpyd	A	C	3: 119,064,951	S605R	probably damaging	Het
Emc1	A	G	4: 139,362,148	E209G	probably damaging	Het
Esrra	A	G	19: 6,920,207	S61P	probably benign	Het
Fam71d	C	A	12: 78,715,075	P171H	probably damaging	Het
Gbx2	T	A	1: 89,933,122		probably benign	Het
Hepacam	A	G	9: 37,384,684	H377R	probably damaging	Het
Igkv12-46	T	C	6: 69,764,550	Y107C	probably damaging	Het
Intu	A	G	3: 40,675,308	D356G	probably damaging	Het
Izumo4	A	T	10: 80,703,220	N113Y	probably damaging	Het
Krt86	G	A	15: 101,473,593	A15T	probably benign	Het
Lhx8	A	T	3: 154,311,679	S275R	probably damaging	Het
Lingo3	A	T	10: 80,835,530	S189T	probably damaging	Het
Llgl1	T	A	11: 60,710,342	M702K	probably benign	Het
Lpin1	T	C	12: 16,573,714	Y223C		Het
Lrit3	G	T	3: 129,788,898	A359E	probably benign	Het
Lrp2	T	C	2: 69,499,263	E1720G	probably benign	Het
Mcub	A	C	3: 129,916,970	V271G	probably benign	Het
Nktr	C	T	9: 121,748,489		probably benign	Het
Olfr1342	T	A	4: 118,689,870	D194V	probably damaging	Het
Olfr1502	G	A	19: 13,862,576	R261H	probably damaging	Het
Olfr347	A	T	2: 36,734,621	Q100L	probably damaging	Het
Olfr617	T	A	7: 103,584,531	Y170N	probably benign	Het
Olfr979	A	T	9: 40,000,621	I202N	possibly damaging	Het
Olfr984	A	T	9: 40,101,244	L82Q	probably damaging	Het
Pcdha4	T	C	18: 36,954,822	V686A	probably benign	Het
Pelo	A	G	13: 115,089,873	V16A	possibly damaging	Het
Plcd1	A	G	9: 119,073,832	S539P	probably benign	Het
Prss1	A	G	6: 41,463,265	I179V	possibly damaging	Het
Ptgs2	T	C	1: 150,105,555	Y530H	probably damaging	Het
Rai1	T	C	11: 60,189,859	V1583A	probably damaging	Het
Raph1	T	G	1: 60,498,473	D508A	probably damaging	Het
Rmnd5a	A	G	6: 71,394,619		probably benign	Het
Rsf1	T	C	7: 97,662,121	L686P	probably benign	Het
Scn1a	T	C	2: 66,273,081	N1934S	probably benign	Het
Sec23ip	C	T	7: 128,750,427	H176Y	probably benign	Het
Sh3glb2	A	G	2: 30,354,851		probably null	Het
Sis	A	G	3: 72,914,576	I1384T	possibly damaging	Het
Spata31d1a	A	C	13: 59,702,618	C565W	probably damaging	Het
Srbd1	T	A	17: 86,127,801	Q278L	probably damaging	Het
Sry	T	C	Y: 2,662,625	H345R	unknown	Het
Suox	A	T	10: 128,671,825	D111E	probably damaging	Het
Taar7a	A	T	10: 23,992,828	F218L	probably benign	Het
Tfcp2l1	C	A	1: 118,664,762	N288K	possibly damaging	Het
Tmem128	G	T	5: 38,260,421	R7L	possibly damaging	Het
Tmem266	A	G	9: 55,437,566	N494S	probably damaging	Het
Tmprss3	T	A	17: 31,193,992	H80L	probably benign	Het
Tnrc6c	C	T	11: 117,749,271	Q1211*	probably null	Het
Tns1	T	A	1: 73,920,596	D1671V	possibly damaging	Het
Trmt1l	T	A	1: 151,435,704		probably benign	Het
Tshz2	A	T	2: 169,884,342	D286V	probably damaging	Het
Ttyh2	A	G	11: 114,675,659	E39G	probably benign	Het
Vmn2r125	G	A	4: 156,350,138	C73Y	probably damaging	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Vmn2r61	T	C	7: 42,300,487	F777S	probably damaging	Het
Vmn2r9	T	C	5: 108,847,561	E407G	probably damaging	Het
Vwa3a	A	G	7: 120,780,235	N521S	probably damaging	Het
Zan	C	G	5: 137,391,762	S4816T	unknown	Het
Zc3h7b	T	C	15: 81,771,858	Y136H	possibly damaging	Het
Zfp101	T	C	17: 33,381,321	K487R	possibly damaging	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACAACTGAGAATAATGTTGGCC -3'
(R):5'- CTCAGCAAATTTACATCCCTTCTACAG -3'

Sequencing Primer
(F):5'- CTGAGAATAATGTTGGCCAAAATG -3'
(R):5'- ACATCCCTTCTACAGAATTTACATTC -3'

Posted On

2016-10-26