Mutagenetix > Incidental Mutations

Incidental Mutation 'R5587:Adamts18'

438822

Institutional Source

Beutler Lab

Gene Symbol

Adamts18

Ensembl Gene

ENSMUSG00000053399

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18

Synonyms

E130314N14Rik

MMRRC Submission

043141-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R5587 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113697126-113848738 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 113775360 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 290 (Q290*)

Ref Sequence

ENSEMBL: ENSMUSP00000090801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]

Predicted Effect

probably null
Transcript: ENSMUST00000093113
AA Change: Q290*

SMART Domains

Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: Q290*

Domain	Start	End	E-Value	Type
signal peptide	1	47	N/A	INTRINSIC
Pfam:Pep_M12B_propep	63	203	3.4e-37	PFAM
Pfam:Reprolysin_5	292	473	1.3e-14	PFAM
Pfam:Reprolysin_4	294	494	2.6e-11	PFAM
Pfam:Reprolysin	294	498	2.7e-30	PFAM
Pfam:Reprolysin_2	311	488	1.7e-14	PFAM
Pfam:Reprolysin_3	315	447	1.5e-11	PFAM
TSP1	592	644	7.37e-17	SMART
Pfam:ADAM_spacer1	749	861	1.7e-38	PFAM
TSP1	878	932	1.55e-1	SMART
TSP1	934	992	5.07e-6	SMART
TSP1	994	1049	1.65e-5	SMART
TSP1	1055	1116	1.71e-3	SMART
TSP1	1125	1171	5.27e-4	SMART
Pfam:PLAC	1186	1216	1.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212527

Predicted Effect

probably benign
Transcript: ENSMUST00000212665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213076

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213078

Meta Mutation Damage Score

0.9711

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

96% (78/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,065,409	R120G	probably benign	Het
4930548H24Rik	G	T	5: 31,486,084	G53W	probably benign	Het
Acad11	A	G	9: 104,063,767	T3A	probably benign	Het
Ahnak	A	G	19: 9,009,476	D2708G	possibly damaging	Het
Asxl3	T	A	18: 22,525,247	C2105S	probably benign	Het
Atp8b1	A	T	18: 64,539,210	F1028I	probably damaging	Het
Axdnd1	C	G	1: 156,351,412	W615C	probably damaging	Het
Bcl3	A	T	7: 19,809,634	Y10*	probably null	Het
Bmp2	T	A	2: 133,554,646	V74E	possibly damaging	Het
Ccdc109b	A	C	3: 129,916,970	V271G	probably benign	Het
Ccdc78	C	A	17: 25,786,677	P21Q	probably benign	Het
Cluap1	T	A	16: 3,915,484	V199E	probably damaging	Het
Cntnap3	T	C	13: 64,746,738	E1120G	probably damaging	Het
Col1a2	T	A	6: 4,540,531	W1330R	unknown	Het
Coq4	A	G	2: 29,795,514		probably null	Het
Cwf19l1	G	A	19: 44,120,877	T346I	possibly damaging	Het
Cyct	T	C	2: 76,354,203	Y68C	probably damaging	Het
Dnah10	T	C	5: 124,793,913	L2368P	probably benign	Het
Dnah2	A	T	11: 69,437,242	F3346I	probably damaging	Het
Dpp3	A	T	19: 4,918,267	V259E	probably damaging	Het
Dpyd	A	C	3: 119,064,951	S605R	probably damaging	Het
Emc1	A	G	4: 139,362,148	E209G	probably damaging	Het
Esrra	A	G	19: 6,920,207	S61P	probably benign	Het
Fam71d	C	A	12: 78,715,075	P171H	probably damaging	Het
Gbx2	T	A	1: 89,933,122		probably benign	Het
Hepacam	A	G	9: 37,384,684	H377R	probably damaging	Het
Igkv12-46	T	C	6: 69,764,550	Y107C	probably damaging	Het
Intu	A	G	3: 40,675,308	D356G	probably damaging	Het
Izumo4	A	T	10: 80,703,220	N113Y	probably damaging	Het
Krt86	G	A	15: 101,473,593	A15T	probably benign	Het
Lhx8	A	T	3: 154,311,679	S275R	probably damaging	Het
Lingo3	A	T	10: 80,835,530	S189T	probably damaging	Het
Llgl1	T	A	11: 60,710,342	M702K	probably benign	Het
Lpin1	T	C	12: 16,573,714	Y223C	probably damaging	Het
Lrit3	G	T	3: 129,788,898	A359E	probably benign	Het
Lrp2	T	C	2: 69,499,263	E1720G	probably benign	Het
Nktr	C	T	9: 121,748,489		probably benign	Het
Olfr1342	T	A	4: 118,689,870	D194V	probably damaging	Het
Olfr1502	G	A	19: 13,862,576	R261H	probably damaging	Het
Olfr347	A	T	2: 36,734,621	Q100L	probably damaging	Het
Olfr617	T	A	7: 103,584,531	Y170N	probably benign	Het
Olfr979	A	T	9: 40,000,621	I202N	possibly damaging	Het
Olfr984	A	T	9: 40,101,244	L82Q	probably damaging	Het
Pcdha4	T	C	18: 36,954,822	V686A	probably benign	Het
Pelo	A	G	13: 115,089,873	V16A	possibly damaging	Het
Plcd1	A	G	9: 119,073,832	S539P	probably benign	Het
Prss1	A	G	6: 41,463,265	I179V	possibly damaging	Het
Ptgs2	T	C	1: 150,105,555	Y530H	probably damaging	Het
Rai1	T	C	11: 60,189,859	V1583A	probably damaging	Het
Raph1	T	G	1: 60,498,473	D508A	probably damaging	Het
Rmnd5a	A	G	6: 71,394,619		probably benign	Het
Rsf1	T	C	7: 97,662,121	L686P	probably benign	Het
Samd9l	T	C	6: 3,373,291	I1323M	possibly damaging	Het
Scn1a	T	C	2: 66,273,081	N1934S	probably benign	Het
Sec23ip	C	T	7: 128,750,427	H176Y	probably benign	Het
Sh3glb2	A	G	2: 30,354,851		probably null	Het
Sis	A	G	3: 72,914,576	I1384T	possibly damaging	Het
Spata31d1a	A	C	13: 59,702,618	C565W	probably damaging	Het
Srbd1	T	A	17: 86,127,801	Q278L	probably damaging	Het
Sry	T	C	Y: 2,662,625	H345R	unknown	Het
Suox	A	T	10: 128,671,825	D111E	probably damaging	Het
Taar7a	A	T	10: 23,992,828	F218L	probably benign	Het
Tfcp2l1	C	A	1: 118,664,762	N288K	possibly damaging	Het
Tmem128	G	T	5: 38,260,421	R7L	possibly damaging	Het
Tmem266	A	G	9: 55,437,566	N494S	probably damaging	Het
Tmprss3	T	A	17: 31,193,992	H80L	probably benign	Het
Tnrc6c	C	T	11: 117,749,271	Q1211*	probably null	Het
Tns1	T	A	1: 73,920,596	D1671V	possibly damaging	Het
Trmt1l	T	A	1: 151,435,704		probably benign	Het
Tshz2	A	T	2: 169,884,342	D286V	probably damaging	Het
Ttyh2	A	G	11: 114,675,659	E39G	probably benign	Het
Vmn2r125	G	A	4: 156,350,138	C73Y	probably damaging	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Vmn2r61	T	C	7: 42,300,487	F777S	probably damaging	Het
Vmn2r9	T	C	5: 108,847,561	E407G	probably damaging	Het
Vwa3a	A	G	7: 120,780,235	N521S	probably damaging	Het
Zan	C	G	5: 137,391,762	S4816T	unknown	Het
Zc3h7b	T	C	15: 81,771,858	Y136H	possibly damaging	Het
Zfp101	T	C	17: 33,381,321	K487R	possibly damaging	Het

Other mutations in Adamts18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Adamts18	APN	8	113774943	missense	probably damaging	1.00
IGL01548:Adamts18	APN	8	113764299	missense	probably damaging	1.00
IGL01556:Adamts18	APN	8	113845109	missense	probably benign	0.01
IGL01833:Adamts18	APN	8	113743096	missense	probably benign	0.10
IGL02187:Adamts18	APN	8	113713194	missense	possibly damaging	0.93
IGL02551:Adamts18	APN	8	113699072	missense	probably damaging	1.00
IGL02756:Adamts18	APN	8	113714344	splice site	probably benign
IGL03188:Adamts18	APN	8	113699024	missense	probably damaging	1.00
IGL03411:Adamts18	APN	8	113764297	nonsense	probably null
R0119:Adamts18	UTSW	8	113774953	missense	possibly damaging	0.94
R0378:Adamts18	UTSW	8	113743117	missense	probably damaging	1.00
R0410:Adamts18	UTSW	8	113714358	nonsense	probably null
R0480:Adamts18	UTSW	8	113738818	missense	possibly damaging	0.93
R0514:Adamts18	UTSW	8	113738769	intron	probably null
R0924:Adamts18	UTSW	8	113705396	splice site	probably null
R0930:Adamts18	UTSW	8	113705396	splice site	probably null
R1333:Adamts18	UTSW	8	113705173	splice site	probably benign
R1441:Adamts18	UTSW	8	113754562	critical splice donor site	probably null
R2082:Adamts18	UTSW	8	113775333	missense	probably damaging	1.00
R2146:Adamts18	UTSW	8	113845003	missense	possibly damaging	0.58
R2371:Adamts18	UTSW	8	113705261	missense	probably benign	0.36
R3148:Adamts18	UTSW	8	113738858	missense	probably damaging	1.00
R3963:Adamts18	UTSW	8	113777811	missense	probably benign	0.00
R4056:Adamts18	UTSW	8	113737580	nonsense	probably null
R4486:Adamts18	UTSW	8	113713193	missense	probably benign	0.00
R4608:Adamts18	UTSW	8	113737613	missense	probably damaging	1.00
R4624:Adamts18	UTSW	8	113773168	nonsense	probably null
R4626:Adamts18	UTSW	8	113773168	nonsense	probably null
R4627:Adamts18	UTSW	8	113773168	nonsense	probably null
R4628:Adamts18	UTSW	8	113773168	nonsense	probably null
R4629:Adamts18	UTSW	8	113773168	nonsense	probably null
R4710:Adamts18	UTSW	8	113706926	missense	probably damaging	0.98
R4959:Adamts18	UTSW	8	113736725	nonsense	probably null
R4973:Adamts18	UTSW	8	113736725	nonsense	probably null
R4976:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5119:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5141:Adamts18	UTSW	8	113775270	missense	probably damaging	1.00
R5422:Adamts18	UTSW	8	113698974	missense	probably benign	0.06
R5868:Adamts18	UTSW	8	113777748	missense	possibly damaging	0.69
R5893:Adamts18	UTSW	8	113773077	missense	probably damaging	1.00
R5906:Adamts18	UTSW	8	113709619	missense	probably benign	0.00
R5942:Adamts18	UTSW	8	113777748	missense	probably benign	0.01
R6006:Adamts18	UTSW	8	113706974	missense	probably damaging	1.00
R6608:Adamts18	UTSW	8	113775279	missense	probably damaging	1.00
R6725:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R7002:Adamts18	UTSW	8	113775290	missense	possibly damaging	0.69
R7276:Adamts18	UTSW	8	113775264	missense	probably damaging	0.99
R7292:Adamts18	UTSW	8	113709645	missense	probably benign	0.00
R7411:Adamts18	UTSW	8	113777730	missense	probably damaging	0.99
R7685:Adamts18	UTSW	8	113713223	missense	probably damaging	1.00
R7737:Adamts18	UTSW	8	113736934	splice site	probably null
R7860:Adamts18	UTSW	8	113775276	missense	probably damaging	1.00
R8197:Adamts18	UTSW	8	113754595	missense	probably damaging	1.00
Z1088:Adamts18	UTSW	8	113775440	missense	possibly damaging	0.86
Z1176:Adamts18	UTSW	8	113743168	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GCCATTTCATCCATACCAGGAAATC -3'
(R):5'- AAATCTCAGGTGCAAAGCCC -3'

Sequencing Primer
(F):5'- ACCAGGAAATCTTTGTCTTAGGG -3'
(R):5'- CCAGGGCAGGTGACAAC -3'

Posted On

2016-10-26