Incidental Mutation 'R5587:Plcd1'
ID438828
Institutional Source Beutler Lab
Gene Symbol Plcd1
Ensembl Gene ENSMUSG00000010660
Gene Namephospholipase C, delta 1
SynonymsPLC-delta 1
MMRRC Submission 043141-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R5587 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119071527-119093502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119073832 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 539 (S539P)
Ref Sequence ENSEMBL: ENSMUSP00000149813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000141185] [ENSMUST00000213464] [ENSMUST00000214470]
Predicted Effect probably benign
Transcript: ENSMUST00000010804
AA Change: S513P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660
AA Change: S513P

DomainStartEndE-ValueType
PH 22 132 9.41e-10 SMART
EFh 144 172 2.87e-2 SMART
EFh 180 208 9.34e1 SMART
Pfam:EF-hand_like 213 295 1.2e-23 PFAM
PLCXc 296 440 5.47e-94 SMART
low complexity region 461 472 N/A INTRINSIC
PLCYc 492 609 1.22e-68 SMART
C2 630 735 1.78e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051386
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074734
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126251
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141185
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153630
Predicted Effect probably benign
Transcript: ENSMUST00000213464
Predicted Effect probably benign
Transcript: ENSMUST00000214470
AA Change: S539P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214491
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene show reduced body size and various abnormalities of the skin and hair including alopecia, epidermal hyperplasia, enlarged sebaceous glands, various kinds of cysts, and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,409 R120G probably benign Het
4930548H24Rik G T 5: 31,486,084 G53W probably benign Het
Acad11 A G 9: 104,063,767 T3A probably benign Het
Adamts18 G A 8: 113,775,360 Q290* probably null Het
Ahnak A G 19: 9,009,476 D2708G possibly damaging Het
Asxl3 T A 18: 22,525,247 C2105S probably benign Het
Atp8b1 A T 18: 64,539,210 F1028I probably damaging Het
Axdnd1 C G 1: 156,351,412 W615C probably damaging Het
Bcl3 A T 7: 19,809,634 Y10* probably null Het
Bmp2 T A 2: 133,554,646 V74E possibly damaging Het
Ccdc109b A C 3: 129,916,970 V271G probably benign Het
Ccdc78 C A 17: 25,786,677 P21Q probably benign Het
Cluap1 T A 16: 3,915,484 V199E probably damaging Het
Cntnap3 T C 13: 64,746,738 E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 W1330R unknown Het
Coq4 A G 2: 29,795,514 probably null Het
Cwf19l1 G A 19: 44,120,877 T346I possibly damaging Het
Cyct T C 2: 76,354,203 Y68C probably damaging Het
Dnah10 T C 5: 124,793,913 L2368P probably benign Het
Dnah2 A T 11: 69,437,242 F3346I probably damaging Het
Dpp3 A T 19: 4,918,267 V259E probably damaging Het
Dpyd A C 3: 119,064,951 S605R probably damaging Het
Emc1 A G 4: 139,362,148 E209G probably damaging Het
Esrra A G 19: 6,920,207 S61P probably benign Het
Fam71d C A 12: 78,715,075 P171H probably damaging Het
Gbx2 T A 1: 89,933,122 probably benign Het
Hepacam A G 9: 37,384,684 H377R probably damaging Het
Igkv12-46 T C 6: 69,764,550 Y107C probably damaging Het
Intu A G 3: 40,675,308 D356G probably damaging Het
Izumo4 A T 10: 80,703,220 N113Y probably damaging Het
Krt86 G A 15: 101,473,593 A15T probably benign Het
Lhx8 A T 3: 154,311,679 S275R probably damaging Het
Lingo3 A T 10: 80,835,530 S189T probably damaging Het
Llgl1 T A 11: 60,710,342 M702K probably benign Het
Lpin1 T C 12: 16,573,714 Y223C probably damaging Het
Lrit3 G T 3: 129,788,898 A359E probably benign Het
Lrp2 T C 2: 69,499,263 E1720G probably benign Het
Nktr C T 9: 121,748,489 probably benign Het
Olfr1342 T A 4: 118,689,870 D194V probably damaging Het
Olfr1502 G A 19: 13,862,576 R261H probably damaging Het
Olfr347 A T 2: 36,734,621 Q100L probably damaging Het
Olfr617 T A 7: 103,584,531 Y170N probably benign Het
Olfr979 A T 9: 40,000,621 I202N possibly damaging Het
Olfr984 A T 9: 40,101,244 L82Q probably damaging Het
Pcdha4 T C 18: 36,954,822 V686A probably benign Het
Pelo A G 13: 115,089,873 V16A possibly damaging Het
Prss1 A G 6: 41,463,265 I179V possibly damaging Het
Ptgs2 T C 1: 150,105,555 Y530H probably damaging Het
Rai1 T C 11: 60,189,859 V1583A probably damaging Het
Raph1 T G 1: 60,498,473 D508A probably damaging Het
Rmnd5a A G 6: 71,394,619 probably benign Het
Rsf1 T C 7: 97,662,121 L686P probably benign Het
Samd9l T C 6: 3,373,291 I1323M possibly damaging Het
Scn1a T C 2: 66,273,081 N1934S probably benign Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sh3glb2 A G 2: 30,354,851 probably null Het
Sis A G 3: 72,914,576 I1384T possibly damaging Het
Spata31d1a A C 13: 59,702,618 C565W probably damaging Het
Srbd1 T A 17: 86,127,801 Q278L probably damaging Het
Sry T C Y: 2,662,625 H345R unknown Het
Suox A T 10: 128,671,825 D111E probably damaging Het
Taar7a A T 10: 23,992,828 F218L probably benign Het
Tfcp2l1 C A 1: 118,664,762 N288K possibly damaging Het
Tmem128 G T 5: 38,260,421 R7L possibly damaging Het
Tmem266 A G 9: 55,437,566 N494S probably damaging Het
Tmprss3 T A 17: 31,193,992 H80L probably benign Het
Tnrc6c C T 11: 117,749,271 Q1211* probably null Het
Tns1 T A 1: 73,920,596 D1671V possibly damaging Het
Trmt1l T A 1: 151,435,704 probably benign Het
Tshz2 A T 2: 169,884,342 D286V probably damaging Het
Ttyh2 A G 11: 114,675,659 E39G probably benign Het
Vmn2r125 G A 4: 156,350,138 C73Y probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r61 T C 7: 42,300,487 F777S probably damaging Het
Vmn2r9 T C 5: 108,847,561 E407G probably damaging Het
Vwa3a A G 7: 120,780,235 N521S probably damaging Het
Zan C G 5: 137,391,762 S4816T unknown Het
Zc3h7b T C 15: 81,771,858 Y136H possibly damaging Het
Zfp101 T C 17: 33,381,321 K487R possibly damaging Het
Other mutations in Plcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Plcd1 APN 9 119076178 missense probably damaging 1.00
IGL01634:Plcd1 APN 9 119073789 missense probably damaging 0.99
IGL01992:Plcd1 APN 9 119075985 missense probably benign
IGL02246:Plcd1 APN 9 119072609 missense probably benign 0.16
IGL02266:Plcd1 APN 9 119074787 splice site probably benign
IGL02270:Plcd1 APN 9 119084641 missense probably damaging 1.00
IGL02281:Plcd1 APN 9 119074773 missense probably benign 0.00
IGL02324:Plcd1 APN 9 119072642 missense probably damaging 0.97
IGL02936:Plcd1 APN 9 119074199 missense probably damaging 1.00
IGL03348:Plcd1 APN 9 119072490 missense possibly damaging 0.91
R0366:Plcd1 UTSW 9 119081136 missense probably damaging 0.99
R1765:Plcd1 UTSW 9 119071806 missense probably damaging 1.00
R3704:Plcd1 UTSW 9 119076209 missense possibly damaging 0.85
R5143:Plcd1 UTSW 9 119074451 nonsense probably null
R5877:Plcd1 UTSW 9 119076172 missense probably damaging 1.00
R6043:Plcd1 UTSW 9 119072599 missense probably damaging 1.00
R6103:Plcd1 UTSW 9 119072041 missense probably benign 0.16
R6338:Plcd1 UTSW 9 119074991 missense probably damaging 1.00
R6339:Plcd1 UTSW 9 119074991 missense probably damaging 1.00
R6496:Plcd1 UTSW 9 119072641 missense possibly damaging 0.79
R6516:Plcd1 UTSW 9 119076203 missense probably damaging 0.99
R6646:Plcd1 UTSW 9 119075032 missense probably damaging 0.99
R6854:Plcd1 UTSW 9 119074321 splice site probably null
R6955:Plcd1 UTSW 9 119071856 missense probably benign 0.01
R7382:Plcd1 UTSW 9 119074691 missense probably damaging 1.00
R7577:Plcd1 UTSW 9 119072254 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AATGCCAACTTGGGACCCTG -3'
(R):5'- TGTGGCTGCCATTCAGATC -3'

Sequencing Primer
(F):5'- TGCAGGGCCGTACGTAG -3'
(R):5'- GGCTGCCATTCAGATCCTCTG -3'
Posted On2016-10-26