Mutagenetix > Incidental Mutations

Incidental Mutation 'R5587:Lpin1'

438839

Institutional Source

Beutler Lab

Gene Symbol

Lpin1

Ensembl Gene

ENSMUSG00000020593

Gene Name

lipin 1

Synonyms

Lipin1

MMRRC Submission

043141-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.460) question?

Stock #

R5587 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16535669-16610966 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16573714 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 223 (Y223C)

Ref Sequence

ENSEMBL: ENSMUSP00000152285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067124] [ENSMUST00000111067] [ENSMUST00000221146] [ENSMUST00000221230] [ENSMUST00000221297] [ENSMUST00000222989]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067124
AA Change: Y223C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000070583
Gene: ENSMUSG00000020593
AA Change: Y223C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	110	1.1e-48	PFAM
low complexity region	153	161	N/A	INTRINSIC
low complexity region	230	242	N/A	INTRINSIC
Pfam:Lipin_mid	498	591	9.4e-36	PFAM
low complexity region	630	642	N/A	INTRINSIC
LNS2	708	864	3.42e-100	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111067
AA Change: Y223C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000106696
Gene: ENSMUSG00000020593
AA Change: Y223C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	2.2e-53	PFAM
low complexity region	153	161	N/A	INTRINSIC
low complexity region	237	252	N/A	INTRINSIC
low complexity region	597	609	N/A	INTRINSIC
LNS2	675	831	3.42e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221146

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221230
AA Change: Y223C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221297
AA Change: Y223C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222989
AA Change: Y223C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

Meta Mutation Damage Score

0.1169

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

96% (78/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
PHENOTYPE: ENU-induced mutants show transient hindlimb paralysis, demyelination and myelin sheath defects. Spontaneous mutants show neonatal fatty liver and hypertriglyceridemia, runting, male sterility, peripheral neuropathy, and altered hair growth, myelination, adipogenesis and lipid and glucose metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,065,409	R120G	probably benign	Het
4930548H24Rik	G	T	5: 31,486,084	G53W	probably benign	Het
Acad11	A	G	9: 104,063,767	T3A	probably benign	Het
Adamts18	G	A	8: 113,775,360	Q290*	probably null	Het
Ahnak	A	G	19: 9,009,476	D2708G	possibly damaging	Het
Asxl3	T	A	18: 22,525,247	C2105S	probably benign	Het
Atp8b1	A	T	18: 64,539,210	F1028I	probably damaging	Het
Axdnd1	C	G	1: 156,351,412	W615C	probably damaging	Het
Bcl3	A	T	7: 19,809,634	Y10*	probably null	Het
Bmp2	T	A	2: 133,554,646	V74E	possibly damaging	Het
Ccdc109b	A	C	3: 129,916,970	V271G	probably benign	Het
Ccdc78	C	A	17: 25,786,677	P21Q	probably benign	Het
Cluap1	T	A	16: 3,915,484	V199E	probably damaging	Het
Cntnap3	T	C	13: 64,746,738	E1120G	probably damaging	Het
Col1a2	T	A	6: 4,540,531	W1330R	unknown	Het
Coq4	A	G	2: 29,795,514		probably null	Het
Cwf19l1	G	A	19: 44,120,877	T346I	possibly damaging	Het
Cyct	T	C	2: 76,354,203	Y68C	probably damaging	Het
Dnah10	T	C	5: 124,793,913	L2368P	probably benign	Het
Dnah2	A	T	11: 69,437,242	F3346I	probably damaging	Het
Dpp3	A	T	19: 4,918,267	V259E	probably damaging	Het
Dpyd	A	C	3: 119,064,951	S605R	probably damaging	Het
Emc1	A	G	4: 139,362,148	E209G	probably damaging	Het
Esrra	A	G	19: 6,920,207	S61P	probably benign	Het
Fam71d	C	A	12: 78,715,075	P171H	probably damaging	Het
Gbx2	T	A	1: 89,933,122		probably benign	Het
Hepacam	A	G	9: 37,384,684	H377R	probably damaging	Het
Igkv12-46	T	C	6: 69,764,550	Y107C	probably damaging	Het
Intu	A	G	3: 40,675,308	D356G	probably damaging	Het
Izumo4	A	T	10: 80,703,220	N113Y	probably damaging	Het
Krt86	G	A	15: 101,473,593	A15T	probably benign	Het
Lhx8	A	T	3: 154,311,679	S275R	probably damaging	Het
Lingo3	A	T	10: 80,835,530	S189T	probably damaging	Het
Llgl1	T	A	11: 60,710,342	M702K	probably benign	Het
Lrit3	G	T	3: 129,788,898	A359E	probably benign	Het
Lrp2	T	C	2: 69,499,263	E1720G	probably benign	Het
Nktr	C	T	9: 121,748,489		probably benign	Het
Olfr1342	T	A	4: 118,689,870	D194V	probably damaging	Het
Olfr1502	G	A	19: 13,862,576	R261H	probably damaging	Het
Olfr347	A	T	2: 36,734,621	Q100L	probably damaging	Het
Olfr617	T	A	7: 103,584,531	Y170N	probably benign	Het
Olfr979	A	T	9: 40,000,621	I202N	possibly damaging	Het
Olfr984	A	T	9: 40,101,244	L82Q	probably damaging	Het
Pcdha4	T	C	18: 36,954,822	V686A	probably benign	Het
Pelo	A	G	13: 115,089,873	V16A	possibly damaging	Het
Plcd1	A	G	9: 119,073,832	S539P	probably benign	Het
Prss1	A	G	6: 41,463,265	I179V	possibly damaging	Het
Ptgs2	T	C	1: 150,105,555	Y530H	probably damaging	Het
Rai1	T	C	11: 60,189,859	V1583A	probably damaging	Het
Raph1	T	G	1: 60,498,473	D508A	probably damaging	Het
Rmnd5a	A	G	6: 71,394,619		probably benign	Het
Rsf1	T	C	7: 97,662,121	L686P	probably benign	Het
Samd9l	T	C	6: 3,373,291	I1323M	possibly damaging	Het
Scn1a	T	C	2: 66,273,081	N1934S	probably benign	Het
Sec23ip	C	T	7: 128,750,427	H176Y	probably benign	Het
Sh3glb2	A	G	2: 30,354,851		probably null	Het
Sis	A	G	3: 72,914,576	I1384T	possibly damaging	Het
Spata31d1a	A	C	13: 59,702,618	C565W	probably damaging	Het
Srbd1	T	A	17: 86,127,801	Q278L	probably damaging	Het
Sry	T	C	Y: 2,662,625	H345R	unknown	Het
Suox	A	T	10: 128,671,825	D111E	probably damaging	Het
Taar7a	A	T	10: 23,992,828	F218L	probably benign	Het
Tfcp2l1	C	A	1: 118,664,762	N288K	possibly damaging	Het
Tmem128	G	T	5: 38,260,421	R7L	possibly damaging	Het
Tmem266	A	G	9: 55,437,566	N494S	probably damaging	Het
Tmprss3	T	A	17: 31,193,992	H80L	probably benign	Het
Tnrc6c	C	T	11: 117,749,271	Q1211*	probably null	Het
Tns1	T	A	1: 73,920,596	D1671V	possibly damaging	Het
Trmt1l	T	A	1: 151,435,704		probably benign	Het
Tshz2	A	T	2: 169,884,342	D286V	probably damaging	Het
Ttyh2	A	G	11: 114,675,659	E39G	probably benign	Het
Vmn2r125	G	A	4: 156,350,138	C73Y	probably damaging	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Vmn2r61	T	C	7: 42,300,487	F777S	probably damaging	Het
Vmn2r9	T	C	5: 108,847,561	E407G	probably damaging	Het
Vwa3a	A	G	7: 120,780,235	N521S	probably damaging	Het
Zan	C	G	5: 137,391,762	S4816T	unknown	Het
Zc3h7b	T	C	15: 81,771,858	Y136H	possibly damaging	Het
Zfp101	T	C	17: 33,381,321	K487R	possibly damaging	Het

Other mutations in Lpin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Lpin1	APN	12	16553992	missense	probably benign	0.00
IGL00929:Lpin1	APN	12	16573699	missense	probably benign	0.05
IGL01485:Lpin1	APN	12	16562357	splice site	probably benign
IGL01750:Lpin1	APN	12	16577176	missense	probably benign	0.00
IGL01774:Lpin1	APN	12	16558476	missense	probably damaging	0.96
IGL02197:Lpin1	APN	12	16558407	critical splice donor site	probably null
IGL02244:Lpin1	APN	12	16541769	missense	probably damaging	0.99
IGL02272:Lpin1	APN	12	16547600	missense	probably damaging	1.00
IGL03366:Lpin1	APN	12	16544677	missense	probably damaging	1.00
lipin	UTSW	12	16547499	missense	probably damaging	1.00
R0044:Lpin1	UTSW	12	16568529	splice site	probably benign
R0106:Lpin1	UTSW	12	16540979	missense	possibly damaging	0.88
R0106:Lpin1	UTSW	12	16540979	missense	possibly damaging	0.88
R0676:Lpin1	UTSW	12	16540979	missense	possibly damaging	0.88
R1119:Lpin1	UTSW	12	16563721	missense	probably damaging	1.00
R1570:Lpin1	UTSW	12	16560998	missense	possibly damaging	0.94
R1611:Lpin1	UTSW	12	16577218	missense	probably null	0.64
R1646:Lpin1	UTSW	12	16573658	critical splice donor site	probably null
R1756:Lpin1	UTSW	12	16538540	missense	probably damaging	0.99
R1870:Lpin1	UTSW	12	16541743	missense	probably damaging	1.00
R1912:Lpin1	UTSW	12	16546727	missense	probably damaging	0.96
R1971:Lpin1	UTSW	12	16580723	missense	probably damaging	1.00
R2484:Lpin1	UTSW	12	16547499	missense	probably damaging	1.00
R2901:Lpin1	UTSW	12	16553998	missense	probably benign
R3195:Lpin1	UTSW	12	16565583	missense	possibly damaging	0.91
R3779:Lpin1	UTSW	12	16564568	missense	probably damaging	0.96
R3918:Lpin1	UTSW	12	16571189	missense	probably benign	0.00
R4532:Lpin1	UTSW	12	16553962	missense	probably benign	0.01
R4857:Lpin1	UTSW	12	16563630	missense	possibly damaging	0.86
R4882:Lpin1	UTSW	12	16538536	missense	probably damaging	1.00
R5024:Lpin1	UTSW	12	16554006	missense	probably benign	0.38
R5084:Lpin1	UTSW	12	16576982	missense	probably damaging	1.00
R5108:Lpin1	UTSW	12	16573715	missense	probably benign	0.39
R5191:Lpin1	UTSW	12	16580828	missense	possibly damaging	0.95
R5377:Lpin1	UTSW	12	16563655	missense	probably damaging	1.00
R5659:Lpin1	UTSW	12	16540989	missense	probably damaging	1.00
R5924:Lpin1	UTSW	12	16544657	missense	possibly damaging	0.91
R6391:Lpin1	UTSW	12	16564553	missense	probably benign	0.29
R6746:Lpin1	UTSW	12	16565528	missense	probably benign
R6799:Lpin1	UTSW	12	16561044	missense	probably damaging	1.00
R6969:Lpin1	UTSW	12	16580861	missense	probably damaging	0.99
R7557:Lpin1	UTSW	12	16580792	missense
R7884:Lpin1	UTSW	12	16562369	missense
R8049:Lpin1	UTSW	12	16563684	missense
R8130:Lpin1	UTSW	12	16579964	missense
R8190:Lpin1	UTSW	12	16549002	missense
R8434:Lpin1	UTSW	12	16563620	critical splice donor site	probably null
R8691:Lpin1	UTSW	12	16573659	critical splice donor site	probably benign
Z1177:Lpin1	UTSW	12	16579947	missense

Predicted Primers

PCR Primer
(F):5'- CAATTCAGCGCAGGTCTGAG -3'
(R):5'- AGGACATGCTAATTAGTGAGGTCC -3'

Sequencing Primer
(F):5'- CGCAGGTCTGAGATTCATTTGCC -3'
(R):5'- ATTAGTGAGGTCCTTAGATGTAAGC -3'

Posted On

2016-10-26