Incidental Mutation 'R5587:Tmprss3'
ID438848
Institutional Source Beutler Lab
Gene Symbol Tmprss3
Ensembl Gene ENSMUSG00000024034
Gene Nametransmembrane protease, serine 3
Synonyms
MMRRC Submission 043141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5587 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31179272-31198975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31193992 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 80 (H80L)
Ref Sequence ENSEMBL: ENSMUSP00000024833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024833] [ENSMUST00000114549]
Predicted Effect probably benign
Transcript: ENSMUST00000024833
AA Change: H80L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000024833
Gene: ENSMUSG00000024034
AA Change: H80L

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
LDLa 72 109 1.76e-5 SMART
SR 108 205 3.99e-4 SMART
Tryp_SPc 216 443 5.22e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114549
AA Change: H102L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110196
Gene: ENSMUSG00000024034
AA Change: H102L

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
LDLa 94 131 1.76e-5 SMART
SR 130 227 3.99e-4 SMART
Tryp_SPc 238 465 5.22e-96 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a serine protease domain, a transmembrane domain, an LDL receptor-like domain, and a scavenger receptor cysteine-rich domain. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified by its association with both congenital and childhood onset autosomal recessive deafness. This gene is expressed in fetal cochlea and many other tissues, and is thought to be involved in the development and maintenance of the inner ear or the contents of the perilymph and endolymph. This gene was also identified as a tumor-associated gene that is overexpressed in ovarian tumors. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit early onset deafness and disrupted vestibular function associated with hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,409 R120G probably benign Het
4930548H24Rik G T 5: 31,486,084 G53W probably benign Het
Acad11 A G 9: 104,063,767 T3A probably benign Het
Adamts18 G A 8: 113,775,360 Q290* probably null Het
Ahnak A G 19: 9,009,476 D2708G possibly damaging Het
Asxl3 T A 18: 22,525,247 C2105S probably benign Het
Atp8b1 A T 18: 64,539,210 F1028I probably damaging Het
Axdnd1 C G 1: 156,351,412 W615C probably damaging Het
Bcl3 A T 7: 19,809,634 Y10* probably null Het
Bmp2 T A 2: 133,554,646 V74E possibly damaging Het
Ccdc109b A C 3: 129,916,970 V271G probably benign Het
Ccdc78 C A 17: 25,786,677 P21Q probably benign Het
Cluap1 T A 16: 3,915,484 V199E probably damaging Het
Cntnap3 T C 13: 64,746,738 E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 W1330R unknown Het
Coq4 A G 2: 29,795,514 probably null Het
Cwf19l1 G A 19: 44,120,877 T346I possibly damaging Het
Cyct T C 2: 76,354,203 Y68C probably damaging Het
Dnah10 T C 5: 124,793,913 L2368P probably benign Het
Dnah2 A T 11: 69,437,242 F3346I probably damaging Het
Dpp3 A T 19: 4,918,267 V259E probably damaging Het
Dpyd A C 3: 119,064,951 S605R probably damaging Het
Emc1 A G 4: 139,362,148 E209G probably damaging Het
Esrra A G 19: 6,920,207 S61P probably benign Het
Fam71d C A 12: 78,715,075 P171H probably damaging Het
Gbx2 T A 1: 89,933,122 probably benign Het
Hepacam A G 9: 37,384,684 H377R probably damaging Het
Igkv12-46 T C 6: 69,764,550 Y107C probably damaging Het
Intu A G 3: 40,675,308 D356G probably damaging Het
Izumo4 A T 10: 80,703,220 N113Y probably damaging Het
Krt86 G A 15: 101,473,593 A15T probably benign Het
Lhx8 A T 3: 154,311,679 S275R probably damaging Het
Lingo3 A T 10: 80,835,530 S189T probably damaging Het
Llgl1 T A 11: 60,710,342 M702K probably benign Het
Lpin1 T C 12: 16,573,714 Y223C probably damaging Het
Lrit3 G T 3: 129,788,898 A359E probably benign Het
Lrp2 T C 2: 69,499,263 E1720G probably benign Het
Nktr C T 9: 121,748,489 probably benign Het
Olfr1342 T A 4: 118,689,870 D194V probably damaging Het
Olfr1502 G A 19: 13,862,576 R261H probably damaging Het
Olfr347 A T 2: 36,734,621 Q100L probably damaging Het
Olfr617 T A 7: 103,584,531 Y170N probably benign Het
Olfr979 A T 9: 40,000,621 I202N possibly damaging Het
Olfr984 A T 9: 40,101,244 L82Q probably damaging Het
Pcdha4 T C 18: 36,954,822 V686A probably benign Het
Pelo A G 13: 115,089,873 V16A possibly damaging Het
Plcd1 A G 9: 119,073,832 S539P probably benign Het
Prss1 A G 6: 41,463,265 I179V possibly damaging Het
Ptgs2 T C 1: 150,105,555 Y530H probably damaging Het
Rai1 T C 11: 60,189,859 V1583A probably damaging Het
Raph1 T G 1: 60,498,473 D508A probably damaging Het
Rmnd5a A G 6: 71,394,619 probably benign Het
Rsf1 T C 7: 97,662,121 L686P probably benign Het
Samd9l T C 6: 3,373,291 I1323M possibly damaging Het
Scn1a T C 2: 66,273,081 N1934S probably benign Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sh3glb2 A G 2: 30,354,851 probably null Het
Sis A G 3: 72,914,576 I1384T possibly damaging Het
Spata31d1a A C 13: 59,702,618 C565W probably damaging Het
Srbd1 T A 17: 86,127,801 Q278L probably damaging Het
Sry T C Y: 2,662,625 H345R unknown Het
Suox A T 10: 128,671,825 D111E probably damaging Het
Taar7a A T 10: 23,992,828 F218L probably benign Het
Tfcp2l1 C A 1: 118,664,762 N288K possibly damaging Het
Tmem128 G T 5: 38,260,421 R7L possibly damaging Het
Tmem266 A G 9: 55,437,566 N494S probably damaging Het
Tnrc6c C T 11: 117,749,271 Q1211* probably null Het
Tns1 T A 1: 73,920,596 D1671V possibly damaging Het
Trmt1l T A 1: 151,435,704 probably benign Het
Tshz2 A T 2: 169,884,342 D286V probably damaging Het
Ttyh2 A G 11: 114,675,659 E39G probably benign Het
Vmn2r125 G A 4: 156,350,138 C73Y probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r61 T C 7: 42,300,487 F777S probably damaging Het
Vmn2r9 T C 5: 108,847,561 E407G probably damaging Het
Vwa3a A G 7: 120,780,235 N521S probably damaging Het
Zan C G 5: 137,391,762 S4816T unknown Het
Zc3h7b T C 15: 81,771,858 Y136H possibly damaging Het
Zfp101 T C 17: 33,381,321 K487R possibly damaging Het
Other mutations in Tmprss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Tmprss3 APN 17 31195008 missense probably damaging 0.97
IGL01836:Tmprss3 APN 17 31191044 missense probably benign
IGL02525:Tmprss3 APN 17 31194891 splice site probably benign
IGL02672:Tmprss3 APN 17 31191007 missense probably damaging 1.00
IGL02900:Tmprss3 APN 17 31184579 missense probably damaging 1.00
R0122:Tmprss3 UTSW 17 31193902 splice site probably benign
R0617:Tmprss3 UTSW 17 31193912 missense probably damaging 1.00
R4001:Tmprss3 UTSW 17 31186559 missense probably damaging 1.00
R6077:Tmprss3 UTSW 17 31189167 missense possibly damaging 0.94
R6271:Tmprss3 UTSW 17 31186562 missense probably damaging 1.00
R6329:Tmprss3 UTSW 17 31183859 nonsense probably null
R6918:Tmprss3 UTSW 17 31188357 missense probably benign 0.19
R8279:Tmprss3 UTSW 17 31197735 missense probably benign 0.20
R8372:Tmprss3 UTSW 17 31184697 missense probably benign 0.00
R8427:Tmprss3 UTSW 17 31188384 missense probably damaging 0.99
R8443:Tmprss3 UTSW 17 31195002 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CATGACGCTGGCTATGGTTG -3'
(R):5'- ATACTGTGGTTGTGGCAGCC -3'

Sequencing Primer
(F):5'- CTATGGTTGGGGTTCATCAGACAG -3'
(R):5'- TCCCTTGGAGTTCAGGACAGAC -3'
Posted On2016-10-26