Incidental Mutation 'R0071:Coro7'
ID43885
Institutional Source Beutler Lab
Gene Symbol Coro7
Ensembl Gene ENSMUSG00000039637
Gene Namecoronin 7
Synonyms0610011B16Rik
MMRRC Submission 038362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R0071 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4626133-4679777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4670527 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 93 (L93Q)
Ref Sequence ENSEMBL: ENSMUSP00000118310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000090480] [ENSMUST00000135823]
Predicted Effect probably damaging
Transcript: ENSMUST00000038552
AA Change: L93Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637
AA Change: L93Q

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090480
AA Change: L93Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087966
Gene: ENSMUSG00000039637
AA Change: L93Q

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127850
Predicted Effect probably damaging
Transcript: ENSMUST00000135823
AA Change: L93Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637
AA Change: L93Q

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144815
Meta Mutation Damage Score 0.8957 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.2%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit disruption of the Golgi apparatus. Mutant fibroblasts show increased cell spreading and cellular F-actin content, increased cell polarization and migration, and enhanced wound healing in a scratch-wound assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 14,088,954 D11G probably damaging Het
4930474N05Rik A G 14: 36,090,789 probably benign Het
Acot12 T C 13: 91,781,174 probably benign Het
Acrbp T C 6: 125,050,952 probably benign Het
AI481877 A G 4: 59,059,643 Y1006H possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Aox3 T A 1: 58,171,891 C931* probably null Het
Apob T A 12: 8,002,111 V1184E probably damaging Het
Arhgap44 A T 11: 65,011,895 L582Q possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Bccip A G 7: 133,714,231 D72G probably damaging Het
Bckdha A T 7: 25,630,443 probably null Het
Cald1 C T 6: 34,758,134 probably benign Het
Cdk11b T C 4: 155,649,423 probably benign Het
Cebpe G T 14: 54,710,604 R261S probably damaging Het
Cep95 C T 11: 106,790,728 probably benign Het
Chil1 T C 1: 134,185,279 Y150H probably benign Het
Chrnd T C 1: 87,192,837 probably benign Het
Clec4g T A 8: 3,717,489 probably benign Het
Cog2 T C 8: 124,548,668 probably benign Het
Csmd3 T C 15: 47,596,821 T3525A probably benign Het
Ctsc G A 7: 88,308,149 probably benign Het
Dnajc16 T C 4: 141,768,007 T467A probably benign Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Fam227b T A 2: 126,124,074 N144Y probably benign Het
Fam83h A G 15: 76,002,528 S987P probably benign Het
Fhod1 A T 8: 105,337,225 probably null Het
Folr1 A G 7: 101,863,923 probably null Het
Glis3 C T 19: 28,263,855 probably benign Het
Gm10069 T C 6: 128,472,725 noncoding transcript Het
Golgb1 G A 16: 36,915,503 R1704Q probably benign Het
Gpr158 C A 2: 21,810,668 T624K probably benign Het
Helz2 T C 2: 181,236,407 Y866C probably damaging Het
Itpkb T A 1: 180,332,765 V152E probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Klhl32 A G 4: 24,743,907 V88A probably damaging Het
Lct C T 1: 128,292,018 W1631* probably null Het
Lipa T A 19: 34,495,082 K313M probably damaging Het
Ly75 T C 2: 60,321,819 K1130R probably benign Het
Mamdc2 C A 19: 23,303,630 E685* probably null Het
Mdm1 A G 10: 118,146,796 E112G probably damaging Het
Metrnl A T 11: 121,716,000 M212L probably benign Het
Mettl2 A G 11: 105,131,642 probably benign Het
Mxd3 A T 13: 55,329,636 L11Q probably damaging Het
Myo7a A T 7: 98,056,830 Y1836N probably damaging Het
Nsun7 A G 5: 66,264,045 Y118C probably benign Het
Obscn G A 11: 59,064,201 T3962M possibly damaging Het
Olfr195 C A 16: 59,149,215 R122S probably benign Het
Olfr53 A T 7: 140,652,257 I93F probably benign Het
Olfr716 A G 7: 107,147,712 Y132C probably damaging Het
Osbpl11 T C 16: 33,214,338 probably benign Het
Pcdhb22 A T 18: 37,520,078 D276V probably damaging Het
Pik3cb A T 9: 99,044,865 D886E probably benign Het
Pkhd1 T A 1: 20,201,344 Y2995F probably benign Het
Raver2 C T 4: 101,120,445 probably benign Het
Rhbdf1 A G 11: 32,210,498 L684P probably damaging Het
Rufy2 C A 10: 62,989,167 L75M possibly damaging Het
Sec22c A G 9: 121,692,913 F44L probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina1a T C 12: 103,855,743 K310R probably benign Het
Sobp A G 10: 43,157,997 L111P probably damaging Het
Sparcl1 G T 5: 104,085,841 Y547* probably null Het
Spata31d1b G A 13: 59,715,349 A104T probably benign Het
Spert A G 14: 75,584,181 S44P probably benign Het
Spsb3 A G 17: 24,887,904 D184G probably damaging Het
Sptan1 A T 2: 30,003,342 K1148* probably null Het
Tdrd12 A G 7: 35,529,246 V17A possibly damaging Het
Tlr9 A G 9: 106,223,578 T23A probably benign Het
Tra2b A T 16: 22,254,401 probably benign Het
Tspan15 A G 10: 62,203,070 probably benign Het
Ttc41 A G 10: 86,736,846 N694S probably benign Het
Ttn T G 2: 76,767,469 D19700A probably damaging Het
Ube3b G A 5: 114,419,497 G1014D probably damaging Het
Unc5d A G 8: 28,719,826 V422A possibly damaging Het
Vmn2r80 C T 10: 79,171,732 T514I possibly damaging Het
Zfp595 T C 13: 67,316,853 K452E possibly damaging Het
Zfp607a A G 7: 27,878,269 K255E probably damaging Het
Zxdc T G 6: 90,370,416 V253G probably damaging Het
Other mutations in Coro7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Coro7 APN 16 4634636 missense possibly damaging 0.83
IGL00885:Coro7 APN 16 4635026 missense probably benign 0.00
IGL02944:Coro7 APN 16 4635412 missense probably benign 0.14
IGL03104:Coro7 APN 16 4629126 missense probably damaging 1.00
IGL03153:Coro7 APN 16 4635382 critical splice donor site probably null
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0080:Coro7 UTSW 16 4630464 missense probably damaging 1.00
R0193:Coro7 UTSW 16 4627504 unclassified probably benign
R0242:Coro7 UTSW 16 4630178 splice site probably benign
R0318:Coro7 UTSW 16 4675807 missense probably benign 0.09
R0554:Coro7 UTSW 16 4632257 missense possibly damaging 0.63
R0666:Coro7 UTSW 16 4631911 missense possibly damaging 0.70
R0835:Coro7 UTSW 16 4632254 missense probably benign 0.12
R0968:Coro7 UTSW 16 4670055 splice site probably benign
R1670:Coro7 UTSW 16 4628233 missense possibly damaging 0.76
R1709:Coro7 UTSW 16 4634441 splice site probably null
R1848:Coro7 UTSW 16 4630434 missense probably damaging 0.99
R1884:Coro7 UTSW 16 4628819 unclassified probably benign
R1935:Coro7 UTSW 16 4628732 missense probably benign
R1937:Coro7 UTSW 16 4628732 missense probably benign
R1939:Coro7 UTSW 16 4628732 missense probably benign
R1967:Coro7 UTSW 16 4634889 missense probably damaging 1.00
R1969:Coro7 UTSW 16 4633756 missense probably benign 0.19
R1970:Coro7 UTSW 16 4633756 missense probably benign 0.19
R3034:Coro7 UTSW 16 4632291 missense probably damaging 0.99
R4638:Coro7 UTSW 16 4632287 missense probably damaging 0.96
R4710:Coro7 UTSW 16 4634933 intron probably benign
R4723:Coro7 UTSW 16 4631994 missense probably benign 0.00
R4789:Coro7 UTSW 16 4628221 missense probably damaging 1.00
R5493:Coro7 UTSW 16 4632487 missense probably damaging 0.99
R5619:Coro7 UTSW 16 4676935 critical splice donor site probably null
R5756:Coro7 UTSW 16 4632284 missense probably damaging 0.97
R5974:Coro7 UTSW 16 4631889 missense possibly damaging 0.83
R6010:Coro7 UTSW 16 4669956 missense possibly damaging 0.68
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6906:Coro7 UTSW 16 4633304 missense probably benign 0.00
R6925:Coro7 UTSW 16 4628674 critical splice donor site probably null
R7069:Coro7 UTSW 16 4679611 start codon destroyed probably damaging 0.99
R7326:Coro7 UTSW 16 4632048 missense probably damaging 0.96
R7421:Coro7 UTSW 16 4668751 missense probably benign 0.19
R7521:Coro7 UTSW 16 4631482 missense probably benign 0.00
R7773:Coro7 UTSW 16 4632006 missense probably damaging 1.00
R7846:Coro7 UTSW 16 4670536 missense probably damaging 1.00
R7929:Coro7 UTSW 16 4670536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCAGCTCTGAGAAGGCAC -3'
(R):5'- CAGCCAAAGGACTCACCAGGATATG -3'

Sequencing Primer
(F):5'- TCTGAGAAGGCACTTGGGG -3'
(R):5'- tgggaggcagagacagg -3'
Posted On2013-05-29