Incidental Mutation 'R5588:Mlph'
ID438861
Institutional Source Beutler Lab
Gene Symbol Mlph
Ensembl Gene ENSMUSG00000026303
Gene Namemelanophilin
Synonymsl1Rk3, l(1)-3Rk, D1Wsu84e, Slac-2a
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5588 (G1)
Quality Score130
Status Not validated
Chromosome1
Chromosomal Location90915085-90951142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90931599 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 219 (S219P)
Ref Sequence ENSEMBL: ENSMUSP00000027528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027528] [ENSMUST00000125149]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027528
AA Change: S219P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027528
Gene: ENSMUSG00000026303
AA Change: S219P

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 2e-51 PFAM
low complexity region 147 160 N/A INTRINSIC
PDB:4KP3|F 170 208 1e-18 PDB
low complexity region 379 406 N/A INTRINSIC
Pfam:Rab_eff_C 437 501 1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125149
SMART Domains Protein: ENSMUSP00000123314
Gene: ENSMUSG00000026303

DomainStartEndE-ValueType
Pfam:FYVE_2 10 98 1.3e-36 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the exophilin subfamily of Rab effector proteins. The protein forms a ternary complex with the small Ras-related GTPase Rab27A in its GTP-bound form and the motor protein myosin Va. A similar protein complex in mouse functions to tether pigment-producing organelles called melanosomes to the actin cytoskeleton in melanocytes, and is required for visible pigmentation in the hair and skin. A mutation in this gene results in Griscelli syndrome type 3, which is characterized by a silver-gray hair color and abnormal pigment distribution in the hair shaft. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous targeted null mutants affect viability and body size, and result in abnormal lungs, kidneys, immune system, hematopoiesis, myelopoiesis, and anomalies in cerebellar foliation and neuronal cell layer development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Mlph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mlph APN 1 90939390 missense probably damaging 1.00
IGL01779:Mlph APN 1 90942950 missense probably benign
IGL01952:Mlph APN 1 90933471 missense probably benign 0.00
beau UTSW 1 90928122 missense probably damaging 1.00
Golem UTSW 1 unclassified
koala UTSW 1 90933301 unclassified probably benign
R0652:Mlph UTSW 1 90942908 missense possibly damaging 0.89
R1374:Mlph UTSW 1 90941703 missense probably damaging 1.00
R1643:Mlph UTSW 1 90941734 missense probably damaging 1.00
R1853:Mlph UTSW 1 90945667 nonsense probably null
R2395:Mlph UTSW 1 90933506 missense probably benign 0.06
R3875:Mlph UTSW 1 90928122 missense probably damaging 1.00
R4632:Mlph UTSW 1 90939386 missense probably damaging 0.99
R4720:Mlph UTSW 1 90941697 missense probably damaging 1.00
R4963:Mlph UTSW 1 90939390 missense probably damaging 1.00
R5901:Mlph UTSW 1 90939814 missense probably damaging 1.00
R6063:Mlph UTSW 1 90928160 missense probably damaging 1.00
R6912:Mlph UTSW 1 90945620 missense probably damaging 0.98
R7019:Mlph UTSW 1 90941706 missense probably damaging 1.00
R7336:Mlph UTSW 1 90921983 splice site probably null
R7491:Mlph UTSW 1 90939378 missense possibly damaging 0.87
X0013:Mlph UTSW 1 90928154 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGGGCTCCTTTGGATCAGTTTC -3'
(R):5'- AAAGTCCCTTTGCCTTGAGAG -3'

Sequencing Primer
(F):5'- TCTAGCTAGAGATAGGTGTCCC -3'
(R):5'- CCTTGAGAGTCTGATGTGACCAC -3'
Posted On2016-10-26