Incidental Mutation 'R5588:Fhdc1'
ID438876
Institutional Source Beutler Lab
Gene Symbol Fhdc1
Ensembl Gene ENSMUSG00000041842
Gene NameFH2 domain containing 1
Synonyms6330505N24Rik
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84442198-84480429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84465476 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 73 (V73A)
Ref Sequence ENSEMBL: ENSMUSP00000142030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091002] [ENSMUST00000107689] [ENSMUST00000194027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091002
AA Change: V170A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088525
Gene: ENSMUSG00000041842
AA Change: V170A

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107689
AA Change: V170A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103317
Gene: ENSMUSG00000041842
AA Change: V170A

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194027
AA Change: V73A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142030
Gene: ENSMUSG00000041842
AA Change: V73A

DomainStartEndE-ValueType
Pfam:FH2 1 145 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Fhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Fhdc1 APN 3 84448800 missense probably damaging 1.00
IGL00556:Fhdc1 APN 3 84457242 missense possibly damaging 0.81
IGL00951:Fhdc1 APN 3 84464313 missense possibly damaging 0.90
IGL01744:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01754:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01762:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01764:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01769:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01778:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01779:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01781:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02243:Fhdc1 APN 3 84474640 start codon destroyed possibly damaging 0.89
IGL02260:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02261:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02266:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02271:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02284:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02292:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02296:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02301:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02347:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02416:Fhdc1 APN 3 84445228 missense probably benign 0.03
IGL03189:Fhdc1 APN 3 84455061 intron probably benign
IGL03392:Fhdc1 APN 3 84444519 missense possibly damaging 0.55
R0125:Fhdc1 UTSW 3 84445545 missense probably benign
R0135:Fhdc1 UTSW 3 84445618 missense probably damaging 0.97
R0255:Fhdc1 UTSW 3 84453510 intron probably benign
R0401:Fhdc1 UTSW 3 84444624 missense probably benign 0.02
R1371:Fhdc1 UTSW 3 84445003 missense probably damaging 1.00
R1727:Fhdc1 UTSW 3 84446176 missense possibly damaging 0.50
R1769:Fhdc1 UTSW 3 84448778 missense probably damaging 1.00
R1781:Fhdc1 UTSW 3 84448804 missense probably damaging 0.99
R1840:Fhdc1 UTSW 3 84445821 missense possibly damaging 0.46
R1970:Fhdc1 UTSW 3 84454851 missense probably damaging 1.00
R2038:Fhdc1 UTSW 3 84444561 missense probably benign 0.22
R2088:Fhdc1 UTSW 3 84474726 start gained probably benign
R2256:Fhdc1 UTSW 3 84446046 missense probably benign
R2939:Fhdc1 UTSW 3 84457270 missense possibly damaging 0.47
R3813:Fhdc1 UTSW 3 84464270 critical splice donor site probably null
R4022:Fhdc1 UTSW 3 84445102 missense probably benign 0.01
R4175:Fhdc1 UTSW 3 84456987 intron probably benign
R4243:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4245:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4290:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4291:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4292:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4293:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4294:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4295:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4334:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4335:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4342:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4344:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4354:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4550:Fhdc1 UTSW 3 84445176 missense probably benign 0.16
R4626:Fhdc1 UTSW 3 84474250 missense probably damaging 1.00
R4925:Fhdc1 UTSW 3 84453533 missense probably damaging 1.00
R5155:Fhdc1 UTSW 3 84446150 missense probably benign 0.00
R6043:Fhdc1 UTSW 3 84448886 missense probably damaging 0.96
R6063:Fhdc1 UTSW 3 84446029 missense probably benign 0.00
R6652:Fhdc1 UTSW 3 84464324 missense probably damaging 1.00
R6706:Fhdc1 UTSW 3 84446422 missense probably damaging 1.00
R6783:Fhdc1 UTSW 3 84445527 missense probably benign 0.00
R6984:Fhdc1 UTSW 3 84444516 missense possibly damaging 0.93
R7182:Fhdc1 UTSW 3 84448850 missense probably damaging 0.98
R7299:Fhdc1 UTSW 3 84444540 missense probably damaging 1.00
R7574:Fhdc1 UTSW 3 84446131 missense probably benign
R7765:Fhdc1 UTSW 3 84444599 missense probably benign 0.04
R8013:Fhdc1 UTSW 3 84474639 start codon destroyed probably null 0.99
R8014:Fhdc1 UTSW 3 84474639 start codon destroyed probably null 0.99
R8139:Fhdc1 UTSW 3 84451483 missense probably damaging 1.00
R8264:Fhdc1 UTSW 3 84455032 missense probably damaging 1.00
R8384:Fhdc1 UTSW 3 84454999 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACAGAGCGACATGTCTAGGG -3'
(R):5'- CCAGTATTATACTTGGACGGGG -3'

Sequencing Primer
(F):5'- CGACATGTCTAGGGCGGAC -3'
(R):5'- GTGGCCCTGGCTATAATATACTAG -3'
Posted On2016-10-26