Incidental Mutation 'R5588:Ppp1r14a'
ID438885
Institutional Source Beutler Lab
Gene Symbol Ppp1r14a
Ensembl Gene ENSMUSG00000037166
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 14A
SynonymsCpi17, 1110001M11Rik
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5588 (G1)
Quality Score172
Status Not validated
Chromosome7
Chromosomal Location29289308-29293801 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29293284 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 137 (P137L)
Ref Sequence ENSEMBL: ENSMUSP00000035642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048187] [ENSMUST00000207714]
Predicted Effect probably damaging
Transcript: ENSMUST00000048187
AA Change: P137L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035642
Gene: ENSMUSG00000037166
AA Change: P137L

DomainStartEndE-ValueType
Pfam:PP1_inhibitor 1 136 2.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207714
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein phosphatase 1 (PP1) inhibitor family. This protein is an inhibitor of smooth muscle myosin phosphatase, and has higher inhibitory activity when phosphorylated. Inhibition of myosin phosphatase leads to increased myosin phosphorylation and enhanced smooth muscle contraction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Ppp1r14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Ppp1r14a APN 7 29293197 missense probably benign 0.01
R4784:Ppp1r14a UTSW 7 29292061 missense possibly damaging 0.82
R4801:Ppp1r14a UTSW 7 29291526 missense probably damaging 1.00
R4802:Ppp1r14a UTSW 7 29291526 missense probably damaging 1.00
R5221:Ppp1r14a UTSW 7 29289501 missense probably damaging 1.00
R5530:Ppp1r14a UTSW 7 29289366 missense probably benign 0.07
R7233:Ppp1r14a UTSW 7 29289524 missense probably damaging 1.00
R7334:Ppp1r14a UTSW 7 29293262 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGAATAAGCTGTTGCCCAAAG -3'
(R):5'- CCAGGAGGAATGTTTCTCCG -3'

Sequencing Primer
(F):5'- CTGTTGCCCAAAGAGACACAGG -3'
(R):5'- AGGAATGTTTCTCCGTCTGTCAG -3'
Posted On2016-10-26