Incidental Mutation 'R5588:Ticrr'
ID 438887
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 043268-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R5588 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79328853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 664 (A664V)
Ref Sequence ENSEMBL: ENSMUSP00000146155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: A664V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: A664V

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206072
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: A664V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000206622
AA Change: A664V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206677
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 81,949,417 (GRCm39) Q1105K possibly damaging Het
Afg3l2 A T 18: 67,573,277 (GRCm39) V175D possibly damaging Het
Aldh1a2 G A 9: 71,190,732 (GRCm39) R325H probably damaging Het
Arhgef18 T A 8: 3,438,878 (GRCm39) probably benign Het
Atp8a1 A G 5: 67,972,027 (GRCm39) L43P probably damaging Het
Bdh1 T C 16: 31,256,937 (GRCm39) probably null Het
Ccdc85c T C 12: 108,177,793 (GRCm39) Y320C probably damaging Het
Cobl A T 11: 12,293,886 (GRCm39) L290* probably null Het
Cyp2c66 A G 19: 39,151,858 (GRCm39) D191G possibly damaging Het
Dhx34 T C 7: 15,932,825 (GRCm39) H1038R probably damaging Het
Eea1 T C 10: 95,859,772 (GRCm39) V686A probably benign Het
Eif2b4 A T 5: 31,349,517 (GRCm39) C101* probably null Het
Eif4a3 A C 11: 119,186,952 (GRCm39) S84A probably benign Het
Elfn2 T C 15: 78,558,076 (GRCm39) D157G probably damaging Het
Fat2 T A 11: 55,173,103 (GRCm39) I2537F probably damaging Het
Fbxo38 A G 18: 62,659,248 (GRCm39) F350L probably damaging Het
Fgd3 A T 13: 49,440,786 (GRCm39) L215Q probably damaging Het
Fhdc1 A G 3: 84,372,783 (GRCm39) V73A possibly damaging Het
Gapvd1 T A 2: 34,599,166 (GRCm39) T690S probably damaging Het
Gask1a C T 9: 121,794,247 (GRCm39) Q134* probably null Het
Gm14418 A T 2: 177,079,065 (GRCm39) I310K probably benign Het
Gm5141 A T 13: 62,921,584 (GRCm39) N528K probably benign Het
Gsap A C 5: 21,456,147 (GRCm39) E417A probably damaging Het
Kcnab1 A C 3: 65,283,976 (GRCm39) D398A possibly damaging Het
Kif5b T G 18: 6,225,787 (GRCm39) N160T probably benign Het
Lilrb4b G A 10: 51,357,422 (GRCm39) R86Q probably benign Het
Lmo7 T C 14: 102,134,026 (GRCm39) probably null Het
Mlph T C 1: 90,859,321 (GRCm39) S219P possibly damaging Het
Ncapg2 T C 12: 116,376,697 (GRCm39) I95T possibly damaging Het
Nedd9 A T 13: 41,469,437 (GRCm39) I572N possibly damaging Het
Nup155 G A 15: 8,148,737 (GRCm39) probably null Het
Olfml2a T C 2: 38,850,047 (GRCm39) S588P probably damaging Het
Or4a68 T C 2: 89,269,760 (GRCm39) R288G probably damaging Het
Or4c12 T A 2: 89,774,136 (GRCm39) T108S probably benign Het
Or6c1 T G 10: 129,517,705 (GRCm39) N301T possibly damaging Het
Parva C A 7: 112,159,269 (GRCm39) N142K possibly damaging Het
Pclo T A 5: 14,838,412 (GRCm39) S4678R unknown Het
Pcnt T C 10: 76,278,445 (GRCm39) D3G possibly damaging Het
Pdzd2 A C 15: 12,374,367 (GRCm39) S1923A possibly damaging Het
Per1 G A 11: 68,998,453 (GRCm39) G1055D probably damaging Het
Phf8-ps G A 17: 33,285,249 (GRCm39) Q518* probably null Het
Plb1 G A 5: 32,487,293 (GRCm39) probably null Het
Ppp1r14a C T 7: 28,992,709 (GRCm39) P137L probably damaging Het
Rfx2 A T 17: 57,086,890 (GRCm39) S612T possibly damaging Het
Rtel1 T C 2: 180,993,893 (GRCm39) F642L probably benign Het
Sec14l3 T C 11: 4,016,138 (GRCm39) F19S probably damaging Het
Skint8 A T 4: 111,794,089 (GRCm39) M160L probably benign Het
Slc19a3 G T 1: 83,000,776 (GRCm39) Y80* probably null Het
Slc37a1 T A 17: 31,565,431 (GRCm39) W489R probably damaging Het
Smc4 A G 3: 68,933,190 (GRCm39) I604V probably benign Het
Srprb G T 9: 103,076,048 (GRCm39) Y796* probably null Het
Tdrd7 T A 4: 45,992,225 (GRCm39) S220T probably benign Het
Tex15 T C 8: 34,067,215 (GRCm39) F2215S probably damaging Het
Tnc T G 4: 63,924,659 (GRCm39) D1013A possibly damaging Het
Tpte T A 8: 22,774,983 (GRCm39) Y18N possibly damaging Het
Ubqlnl T A 7: 103,798,339 (GRCm39) Q386L probably damaging Het
Vmn1r194 T C 13: 22,428,512 (GRCm39) V43A possibly damaging Het
Vmn2r130 A T 17: 23,282,803 (GRCm39) Q161L probably benign Het
Vmn2r5 T C 3: 64,411,497 (GRCm39) D357G probably damaging Het
Zfhx4 T G 3: 5,468,198 (GRCm39) D2785E probably damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGAAGACAAAAGTCTCTGTCCC -3'
(R):5'- AATTGTACCAATCCTCTACTCAGC -3'

Sequencing Primer
(F):5'- CCCCTTACAGGATACATGGAGTTG -3'
(R):5'- GCAGTGCTTTTACAATGAGCC -3'
Posted On 2016-10-26