Incidental Mutation 'R5588:Lilr4b'
ID438896
Institutional Source Beutler Lab
Gene Symbol Lilr4b
Ensembl Gene ENSMUSG00000112023
Gene Nameleukocyte immunoglobulin-like receptor, subfamily B, member 4B
SynonymsGp49a, gp49
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location51480632-51486703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 51481326 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 86 (R86Q)
Ref Sequence ENSEMBL: ENSMUSP00000099958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102894] [ENSMUST00000217706] [ENSMUST00000218123] [ENSMUST00000218704] [ENSMUST00000219696] [ENSMUST00000219960] [ENSMUST00000219661]
Predicted Effect probably benign
Transcript: ENSMUST00000102894
AA Change: R86Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099958
Gene: ENSMUSG00000112023
AA Change: R86Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1nkr_2 24 118 3e-14 SMART
Blast:IG_like 28 118 5e-49 BLAST
Pfam:Ig_3 123 200 6.5e-8 PFAM
Pfam:Ig_2 123 218 5.9e-8 PFAM
Pfam:ig 127 211 8.4e-9 PFAM
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139982
Predicted Effect probably benign
Transcript: ENSMUST00000217706
Predicted Effect probably benign
Transcript: ENSMUST00000218123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218649
Predicted Effect probably benign
Transcript: ENSMUST00000218704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219262
Predicted Effect probably benign
Transcript: ENSMUST00000219696
Predicted Effect probably benign
Transcript: ENSMUST00000219960
Predicted Effect probably benign
Transcript: ENSMUST00000219661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219717
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Lilr4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Lilr4b APN 10 51481251 missense probably benign 0.00
IGL02457:Lilr4b APN 10 51481238 missense probably benign 0.04
IGL03221:Lilr4b APN 10 51481428 splice site probably benign
IGL03396:Lilr4b APN 10 51481157 missense possibly damaging 0.71
R0145:Lilr4b UTSW 10 51484518 missense probably benign 0.00
R0336:Lilr4b UTSW 10 51481293 missense probably benign 0.28
R1313:Lilr4b UTSW 10 51480736 missense probably benign 0.25
R1543:Lilr4b UTSW 10 51481421 missense probably damaging 0.98
R1984:Lilr4b UTSW 10 51481735 missense possibly damaging 0.68
R1985:Lilr4b UTSW 10 51481735 missense possibly damaging 0.68
R2243:Lilr4b UTSW 10 51481608 missense possibly damaging 0.88
R4094:Lilr4b UTSW 10 51481410 missense probably damaging 0.99
R4887:Lilr4b UTSW 10 51484520 missense possibly damaging 0.81
R6404:Lilr4b UTSW 10 51485729 missense probably damaging 0.99
R8347:Lilr4b UTSW 10 51481754 missense probably damaging 1.00
Z1177:Lilr4b UTSW 10 51481349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTCTTCACAGGACACCTCC -3'
(R):5'- TACCCACATTGTCCTCCAGG -3'

Sequencing Primer
(F):5'- TCCCAAAACCCATCATCTGG -3'
(R):5'- TTGGACTCTGAGAGAAGAGCTCC -3'
Posted On2016-10-26