Incidental Mutation 'R5588:Cobl'
ID438901
Institutional Source Beutler Lab
Gene Symbol Cobl
Ensembl Gene ENSMUSG00000020173
Gene Namecordon-bleu WH2 repeat
SynonymsC530045F18Rik
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location12236608-12464960 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 12343886 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 290 (L290*)
Ref Sequence ENSEMBL: ENSMUSP00000133470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172827] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]
Predicted Effect probably null
Transcript: ENSMUST00000046755
AA Change: L297*
SMART Domains Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: L297*

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 144 235 2.2e-46 PFAM
low complexity region 328 333 N/A INTRINSIC
low complexity region 360 376 N/A INTRINSIC
low complexity region 408 433 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
coiled coil region 564 589 N/A INTRINSIC
WH2 1185 1205 1.32e0 SMART
WH2 1225 1245 6.36e-3 SMART
low complexity region 1276 1296 N/A INTRINSIC
WH2 1313 1333 3.91e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109650
AA Change: L272*
SMART Domains Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: L272*

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.6e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
coiled coil region 482 507 N/A INTRINSIC
WH2 1103 1123 1.32e0 SMART
WH2 1143 1163 6.36e-3 SMART
low complexity region 1194 1214 N/A INTRINSIC
WH2 1231 1251 3.91e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109651
AA Change: L272*
SMART Domains Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: L272*

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.2e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 383 408 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
coiled coil region 539 564 N/A INTRINSIC
WH2 1160 1180 1.32e0 SMART
WH2 1200 1220 6.36e-3 SMART
low complexity region 1251 1271 N/A INTRINSIC
WH2 1288 1308 3.91e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130572
Predicted Effect probably null
Transcript: ENSMUST00000136549
AA Change: L51*
SMART Domains Protein: ENSMUSP00000114779
Gene: ENSMUSG00000020173
AA Change: L51*

DomainStartEndE-ValueType
low complexity region 83 88 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146067
AA Change: L203*
SMART Domains Protein: ENSMUSP00000119008
Gene: ENSMUSG00000020173
AA Change: L203*

DomainStartEndE-ValueType
Pfam:Cobl 35 142 5e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172827
AA Change: L69*
SMART Domains Protein: ENSMUSP00000133368
Gene: ENSMUSG00000020173
AA Change: L69*

DomainStartEndE-ValueType
Pfam:Cobl 1 32 1.2e-9 PFAM
low complexity region 100 105 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172919
AA Change: L297*
SMART Domains Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173
AA Change: L297*

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.6e-41 PFAM
low complexity region 328 333 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172956
AA Change: L272*
SMART Domains Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173
AA Change: L272*

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.4e-41 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174550
Predicted Effect probably null
Transcript: ENSMUST00000174874
AA Change: L290*
SMART Domains Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: L290*

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Pfam:Cobl 175 253 1.2e-40 PFAM
low complexity region 321 326 N/A INTRINSIC
low complexity region 353 369 N/A INTRINSIC
low complexity region 401 426 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
low complexity region 519 534 N/A INTRINSIC
coiled coil region 557 582 N/A INTRINSIC
WH2 1178 1198 1.32e0 SMART
WH2 1218 1238 6.36e-3 SMART
low complexity region 1269 1289 N/A INTRINSIC
WH2 1306 1326 3.91e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Cobl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cobl APN 11 12375813 missense possibly damaging 0.89
IGL00698:Cobl APN 11 12253722 missense probably benign 0.41
IGL00772:Cobl APN 11 12266985 missense probably benign 0.02
IGL00922:Cobl APN 11 12254866 missense probably damaging 1.00
IGL00985:Cobl APN 11 12254843 missense probably damaging 1.00
IGL01641:Cobl APN 11 12309641 nonsense probably null
IGL01722:Cobl APN 11 12253987 missense probably benign 0.00
IGL01734:Cobl APN 11 12254980 splice site probably benign
IGL01924:Cobl APN 11 12254596 missense probably benign 0.30
IGL02105:Cobl APN 11 12249651 missense probably damaging 1.00
IGL02326:Cobl APN 11 12386712 missense possibly damaging 0.69
IGL02342:Cobl APN 11 12253672 missense possibly damaging 0.64
IGL02426:Cobl APN 11 12254351 nonsense probably null
IGL02754:Cobl APN 11 12254371 missense probably damaging 1.00
IGL02754:Cobl APN 11 12254370 missense probably damaging 1.00
IGL02811:Cobl APN 11 12253285 missense possibly damaging 0.56
IGL02859:Cobl APN 11 12369602 missense probably damaging 1.00
IGL02999:Cobl APN 11 12343869 missense possibly damaging 0.71
IGL03030:Cobl APN 11 12254241 missense possibly damaging 0.80
IGL03191:Cobl APN 11 12253364 missense probably benign 0.00
PIT4418001:Cobl UTSW 11 12256240 missense possibly damaging 0.79
PIT4480001:Cobl UTSW 11 12253592 missense probably benign
PIT4495001:Cobl UTSW 11 12254596 missense probably benign 0.00
R0031:Cobl UTSW 11 12254945 missense probably benign 0.36
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0322:Cobl UTSW 11 12267072 missense probably damaging 1.00
R0597:Cobl UTSW 11 12254699 missense probably benign 0.24
R0733:Cobl UTSW 11 12365167 missense probably benign 0.31
R0734:Cobl UTSW 11 12375971 missense probably damaging 1.00
R0784:Cobl UTSW 11 12266843 splice site probably benign
R0884:Cobl UTSW 11 12375908 missense possibly damaging 0.89
R1065:Cobl UTSW 11 12254327 missense possibly damaging 0.67
R1331:Cobl UTSW 11 12375853 missense probably damaging 0.96
R1892:Cobl UTSW 11 12253258 missense probably damaging 0.99
R2847:Cobl UTSW 11 12378342 missense probably damaging 1.00
R2848:Cobl UTSW 11 12378342 missense probably damaging 1.00
R3407:Cobl UTSW 11 12375830 missense probably damaging 1.00
R4627:Cobl UTSW 11 12251093 missense probably damaging 1.00
R4662:Cobl UTSW 11 12253672 missense probably benign 0.08
R4677:Cobl UTSW 11 12386665 missense possibly damaging 0.93
R4844:Cobl UTSW 11 12254740 missense probably benign 0.10
R4942:Cobl UTSW 11 12254185 missense probably damaging 0.99
R5158:Cobl UTSW 11 12256198 missense possibly damaging 0.84
R5195:Cobl UTSW 11 12253565 missense probably benign 0.02
R5255:Cobl UTSW 11 12375825 missense probably damaging 1.00
R5637:Cobl UTSW 11 12296531 intron probably benign
R5643:Cobl UTSW 11 12306948 splice site probably benign
R5749:Cobl UTSW 11 12266965 missense possibly damaging 0.86
R5953:Cobl UTSW 11 12256220 missense probably benign 0.00
R6000:Cobl UTSW 11 12369684 missense probably benign 0.08
R6373:Cobl UTSW 11 12253118 missense probably damaging 1.00
R7034:Cobl UTSW 11 12254177 missense probably damaging 1.00
R7071:Cobl UTSW 11 12254795 missense probably benign 0.00
R7077:Cobl UTSW 11 12253441 missense probably benign 0.04
R7078:Cobl UTSW 11 12378271 missense probably damaging 1.00
R7099:Cobl UTSW 11 12296540 missense
R7153:Cobl UTSW 11 12254128 missense probably damaging 1.00
R7448:Cobl UTSW 11 12256225 missense possibly damaging 0.46
R7519:Cobl UTSW 11 12253124 missense probably damaging 1.00
R7767:Cobl UTSW 11 12412117 start gained probably benign
R7772:Cobl UTSW 11 12254488 missense probably benign 0.29
R7841:Cobl UTSW 11 12253324 missense probably damaging 1.00
R7845:Cobl UTSW 11 12365139 missense probably benign 0.35
R8026:Cobl UTSW 11 12253459 missense probably benign 0.01
R8118:Cobl UTSW 11 12254834 missense probably benign 0.03
R8192:Cobl UTSW 11 12249745 missense probably benign 0.07
R8320:Cobl UTSW 11 12267001 missense probably damaging 1.00
R8338:Cobl UTSW 11 12253696 missense probably benign 0.41
Z1176:Cobl UTSW 11 12253433 missense probably benign 0.02
Z1176:Cobl UTSW 11 12369645 missense probably damaging 1.00
Z1176:Cobl UTSW 11 12375827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCAAGGACCCGCAGTAGAG -3'
(R):5'- AAAGCATAAAATGTTTCCTAGGGG -3'

Sequencing Primer
(F):5'- CCGCAGTAGAGTTAACTGGGTC -3'
(R):5'- GGGGAATAGTAATAAGAATCTTGCTC -3'
Posted On2016-10-26