Incidental Mutation 'R5588:Eif4a3'
ID438905
Institutional Source Beutler Lab
Gene Symbol Eif4a3
Ensembl Gene ENSMUSG00000025580
Gene Nameeukaryotic translation initiation factor 4A3
Synonyms2400003O03Rik, Ddx48
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119288363-119300089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119296126 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 84 (S84A)
Ref Sequence ENSEMBL: ENSMUSP00000101860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026667] [ENSMUST00000106253]
Predicted Effect probably benign
Transcript: ENSMUST00000026667
AA Change: S84A

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026667
Gene: ENSMUSG00000025580
AA Change: S84A

DomainStartEndE-ValueType
DEXDc 57 254 2.44e-57 SMART
HELICc 291 372 1.63e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106253
AA Change: S84A

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101860
Gene: ENSMUSG00000025580
AA Change: S84A

DomainStartEndE-ValueType
DEXDc 57 233 2.28e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135294
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a nuclear matrix protein. Its amino acid sequence is highly similar to the amino acid sequences of the translation initiation factors eIF4AI and eIF4AII, two other members of the DEAD box protein family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Eif4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Eif4a3 APN 11 119293561 missense probably damaging 1.00
IGL03204:Eif4a3 APN 11 119293616 missense possibly damaging 0.90
R1916:Eif4a3 UTSW 11 119293911 missense probably benign 0.00
R4969:Eif4a3 UTSW 11 119288879 missense probably damaging 1.00
R5317:Eif4a3 UTSW 11 119294664 missense probably damaging 0.99
R8031:Eif4a3 UTSW 11 119288905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGTTGGCAGGCAAGAGCG -3'
(R):5'- CATCTTTGCAGCTAAGGTGTTT -3'

Sequencing Primer
(F):5'- TGTGCAGGCCAGAATTTCC -3'
(R):5'- AACAGTTACAGTGTCTGCCTGGAC -3'
Posted On2016-10-26