Incidental Mutation 'R5588:Ccdc85c'
ID438906
Institutional Source Beutler Lab
Gene Symbol Ccdc85c
Ensembl Gene ENSMUSG00000084883
Gene Namecoiled-coil domain containing 85C
SynonymsGm9010
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location108203602-108275425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108211534 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 320 (Y320C)
Ref Sequence ENSEMBL: ENSMUSP00000152421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136175] [ENSMUST00000222310]
Predicted Effect probably damaging
Transcript: ENSMUST00000136175
AA Change: Y333C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125757
Gene: ENSMUSG00000084883
AA Change: Y333C

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:DUF2216 16 220 6.9e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000222310
AA Change: Y320C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice display hydrocephalus, intracranial hemorrhage due to ventricular dilatation, and heterotopia in the subcortical regions. Hydroencephaly usually becomes evident before 15 weeks of age and affected animals die within several days after notice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Ccdc85c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ccdc85c APN 12 108207844 missense probably damaging 1.00
IGL02061:Ccdc85c APN 12 108221743 missense probably damaging 1.00
IGL02316:Ccdc85c APN 12 108211570 missense probably damaging 1.00
IGL02516:Ccdc85c APN 12 108274901 missense unknown
IGL03146:Ccdc85c APN 12 108207136 nonsense probably null
FR4304:Ccdc85c UTSW 12 108274612 small insertion probably benign
FR4449:Ccdc85c UTSW 12 108274616 small insertion probably benign
R4685:Ccdc85c UTSW 12 108207175 missense probably benign 0.33
R5048:Ccdc85c UTSW 12 108221707 critical splice donor site probably null
R5516:Ccdc85c UTSW 12 108207850 missense probably damaging 1.00
R6054:Ccdc85c UTSW 12 108274769 missense unknown
R6318:Ccdc85c UTSW 12 108274709 missense unknown
R7094:Ccdc85c UTSW 12 108274618 frame shift probably null
R8167:Ccdc85c UTSW 12 108274500 missense unknown
RF008:Ccdc85c UTSW 12 108274628 small insertion probably benign
RF044:Ccdc85c UTSW 12 108274612 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCGAGAAATGTCACCTACC -3'
(R):5'- TACTAAGCACAGCACCTGGG -3'

Sequencing Primer
(F):5'- GAAATGTCACCTACCCAATGCTTTG -3'
(R):5'- GCTAGGGCAGGGTCTTGGC -3'
Posted On2016-10-26