Incidental Mutation 'R5588:Nedd9'
ID438909
Institutional Source Beutler Lab
Gene Symbol Nedd9
Ensembl Gene ENSMUSG00000021365
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 9
SynonymsE230025G09Rik, HEF1, Cas-L, CasL
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location41309581-41487362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41315961 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 572 (I572N)
Ref Sequence ENSEMBL: ENSMUSP00000125773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021794] [ENSMUST00000163623] [ENSMUST00000224803]
Predicted Effect probably benign
Transcript: ENSMUST00000021794
AA Change: I572N

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021794
Gene: ENSMUSG00000021365
AA Change: I572N

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.33e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 561 3.2e-66 PFAM
Pfam:DUF3513 611 828 1.4e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163623
AA Change: I572N

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125773
Gene: ENSMUSG00000021365
AA Change: I572N

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.42e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 559 2.7e-60 PFAM
Pfam:DUF3513 618 827 1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224803
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CRK-associated substrates family. Members of this family are adhesion docking molecules that mediate protein-protein interactions for signal transduction pathways. This protein is a focal adhesion protein that acts as a scaffold to regulate signaling complexes important in cell attachment, migration and invasion as well as apoptosis and the cell cycle. This protein has also been reported to have a role in cancer metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for one null allele exhibit impaired lymphocyte trafficking and a deficit of splenic marginal zone B cells. Mice homozygous for another null allele display impaired spatial learning and decreased hippocampal dendritic spine densities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Nedd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Nedd9 APN 13 41316234 missense probably benign 0.00
IGL01412:Nedd9 APN 13 41315786 nonsense probably null
IGL01669:Nedd9 APN 13 41338635 missense probably damaging 0.99
IGL02543:Nedd9 APN 13 41316735 missense probably damaging 1.00
IGL03302:Nedd9 APN 13 41338854 missense probably damaging 0.99
hebei UTSW 13 41338979 nonsense probably null
sheep UTSW 13 41317962 missense probably benign 0.33
yanzhao UTSW 13 41311794 missense probably damaging 1.00
R1157:Nedd9 UTSW 13 41314503 splice site probably null
R1611:Nedd9 UTSW 13 41316930 missense probably benign
R1669:Nedd9 UTSW 13 41311794 missense probably damaging 1.00
R1718:Nedd9 UTSW 13 41338926 missense probably damaging 1.00
R1775:Nedd9 UTSW 13 41317962 missense probably benign 0.33
R1971:Nedd9 UTSW 13 41338948 missense probably damaging 1.00
R2107:Nedd9 UTSW 13 41338979 nonsense probably null
R2341:Nedd9 UTSW 13 41316511 missense probably damaging 1.00
R4362:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4363:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4707:Nedd9 UTSW 13 41338575 critical splice donor site probably null
R4724:Nedd9 UTSW 13 41316597 missense possibly damaging 0.50
R4795:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4796:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4853:Nedd9 UTSW 13 41316361 missense probably benign 0.01
R4934:Nedd9 UTSW 13 41338935 missense probably damaging 1.00
R5020:Nedd9 UTSW 13 41315794 missense probably damaging 1.00
R5070:Nedd9 UTSW 13 41316598 missense probably benign 0.00
R5585:Nedd9 UTSW 13 41316474 missense probably damaging 1.00
R6310:Nedd9 UTSW 13 41318452 missense probably benign 0.00
R6634:Nedd9 UTSW 13 41312108 missense probably damaging 1.00
R6729:Nedd9 UTSW 13 41315802 missense probably damaging 0.99
R7114:Nedd9 UTSW 13 41338623 missense probably benign
R7172:Nedd9 UTSW 13 41316804 missense probably benign 0.01
R7477:Nedd9 UTSW 13 41318480 missense probably benign 0.02
R7665:Nedd9 UTSW 13 41316309 missense probably benign 0.01
R7672:Nedd9 UTSW 13 41338722 missense possibly damaging 0.69
R7810:Nedd9 UTSW 13 41312007 missense possibly damaging 0.52
R7893:Nedd9 UTSW 13 41315789 missense probably damaging 1.00
R7952:Nedd9 UTSW 13 41316955 missense probably damaging 1.00
R8215:Nedd9 UTSW 13 41338843 missense probably benign 0.14
R8399:Nedd9 UTSW 13 41318474 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATCAGCCTCCTATCGGTC -3'
(R):5'- AATGAATGCAGCTGGTCCC -3'

Sequencing Primer
(F):5'- TATCGGTCCAGCTCACAGC -3'
(R):5'- GCAGCTGGTCCCTGAATATTTTAGC -3'
Posted On2016-10-26