Mutagenetix > Incidental Mutations

Incidental Mutation 'R5588:Pdzd2'

438914

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

043268-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.134) question?

Stock #

R5588 (G1)

Quality Score

153

Status

Not validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 12374281 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 1923 (S1923A)

Ref Sequence

ENSEMBL: ENSMUSP00000074788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075317
AA Change: S1923A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: S1923A

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	G	A	17: 33,066,275	Q518*	probably null	Het
4930407I10Rik	C	A	15: 82,065,216	Q1105K	possibly damaging	Het
A430078G23Rik	T	A	8: 3,388,878		probably benign	Het
Afg3l2	A	T	18: 67,440,207	V175D	possibly damaging	Het
Aldh1a2	G	A	9: 71,283,450	R325H	probably damaging	Het
Atp8a1	A	G	5: 67,814,684	L43P	probably damaging	Het
Bdh1	T	C	16: 31,438,119		probably null	Het
Ccdc85c	T	C	12: 108,211,534	Y320C	probably damaging	Het
Cobl	A	T	11: 12,343,886	L290*	probably null	Het
Cyp2c66	A	G	19: 39,163,414	D191G	possibly damaging	Het
Dhx34	T	C	7: 16,198,900	H1038R	probably damaging	Het
Eea1	T	C	10: 96,023,910	V686A	probably benign	Het
Eif2b4	A	T	5: 31,192,173	C101*	probably null	Het
Eif4a3	A	C	11: 119,296,126	S84A	probably benign	Het
Elfn2	T	C	15: 78,673,876	D157G	probably damaging	Het
Fam198a	C	T	9: 121,965,181	Q134*	probably null	Het
Fat2	T	A	11: 55,282,277	I2537F	probably damaging	Het
Fbxo38	A	G	18: 62,526,177	F350L	probably damaging	Het
Fgd3	A	T	13: 49,287,310	L215Q	probably damaging	Het
Fhdc1	A	G	3: 84,465,476	V73A	possibly damaging	Het
Gapvd1	T	A	2: 34,709,154	T690S	probably damaging	Het
Gm14418	A	T	2: 177,387,272	I310K	probably benign	Het
Gm5141	A	T	13: 62,773,770	N528K	probably benign	Het
Gsap	A	C	5: 21,251,149	E417A	probably damaging	Het
Kcnab1	A	C	3: 65,376,555	D398A	possibly damaging	Het
Kif5b	T	G	18: 6,225,787	N160T	probably benign	Het
Lilr4b	G	A	10: 51,481,326	R86Q	probably benign	Het
Lmo7	T	C	14: 101,896,590		probably null	Het
Mlph	T	C	1: 90,931,599	S219P	possibly damaging	Het
Ncapg2	T	C	12: 116,413,077	I95T	possibly damaging	Het
Nedd9	A	T	13: 41,315,961	I572N	possibly damaging	Het
Nup155	G	A	15: 8,119,253		probably null	Het
Olfml2a	T	C	2: 38,960,035	S588P	probably damaging	Het
Olfr1240	T	C	2: 89,439,416	R288G	probably damaging	Het
Olfr1259	T	A	2: 89,943,792	T108S	probably benign	Het
Olfr802	T	G	10: 129,681,836	N301T	possibly damaging	Het
Parva	C	A	7: 112,560,062	N142K	possibly damaging	Het
Pclo	T	A	5: 14,788,398	S4678R	unknown	Het
Pcnt	T	C	10: 76,442,611	D3G	possibly damaging	Het
Per1	G	A	11: 69,107,627	G1055D	probably damaging	Het
Plb1	G	A	5: 32,329,949		probably null	Het
Ppp1r14a	C	T	7: 29,293,284	P137L	probably damaging	Het
Rfx2	A	T	17: 56,779,890	S612T	possibly damaging	Het
Rtel1	T	C	2: 181,352,100	F642L	probably benign	Het
Sec14l3	T	C	11: 4,066,138	F19S	probably damaging	Het
Skint8	A	T	4: 111,936,892	M160L	probably benign	Het
Slc19a3	G	T	1: 83,023,055	Y80*	probably null	Het
Slc37a1	T	A	17: 31,346,457	W489R	probably damaging	Het
Smc4	A	G	3: 69,025,857	I604V	probably benign	Het
Srprb	G	T	9: 103,198,849	Y796*	probably null	Het
Tdrd7	T	A	4: 45,992,225	S220T	probably benign	Het
Tex15	T	C	8: 33,577,187	F2215S	probably damaging	Het
Ticrr	C	T	7: 79,679,105	A664V	probably damaging	Het
Tnc	T	G	4: 64,006,422	D1013A	possibly damaging	Het
Tpte	T	A	8: 22,284,967	Y18N	possibly damaging	Het
Ubqlnl	T	A	7: 104,149,132	Q386L	probably damaging	Het
Vmn1r194	T	C	13: 22,244,342	V43A	possibly damaging	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Vmn2r-ps130	A	T	17: 23,063,829	Q161L	probably benign	Het
Zfhx4	T	G	3: 5,403,138	D2785E	probably damaging	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0446:Pdzd2	UTSW	15	12375024	missense	probably benign	0.43
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1099:Pdzd2	UTSW	15	12373087	missense	probably damaging	1.00
R1122:Pdzd2	UTSW	15	12457895	missense	probably benign	0.25
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2155:Pdzd2	UTSW	15	12375793	missense	probably benign	0.43
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5174:Pdzd2	UTSW	15	12372514	missense	probably benign	0.01
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5256:Pdzd2	UTSW	15	12372942	missense	possibly damaging	0.87
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	splice site	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R6992:Pdzd2	UTSW	15	12457859	missense	probably damaging	1.00
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7712:Pdzd2	UTSW	15	12407336	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
R8017:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8019:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8108:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8109:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8110:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8111:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8145:Pdzd2	UTSW	15	12407372	missense	probably benign	0.37
R8220:Pdzd2	UTSW	15	12592163	missense	probably damaging	0.99
R8278:Pdzd2	UTSW	15	12375909	missense	probably benign
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCTATATTGGTCCTCGATGCG -3'
(R):5'- CAGGAAGTCCTTGCCTTCAC -3'

Sequencing Primer
(F):5'- TCACTGACCCAGAGTTAGCATGG -3'
(R):5'- CCCCAGGCTGCCCATAAAATG -3'

Posted On

2016-10-26