Incidental Mutation 'R5588:4921501E09Rik'
ID438920
Institutional Source Beutler Lab
Gene Symbol 4921501E09Rik
Ensembl Gene ENSMUSG00000023350
Gene NameRIKEN cDNA 4921501E09 gene
Synonyms
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33064143-33068058 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 33066275 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 518 (Q518*)
Ref Sequence ENSEMBL: ENSMUSP00000024121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024121]
Predicted Effect probably null
Transcript: ENSMUST00000024121
AA Change: Q518*
SMART Domains Protein: ENSMUSP00000024121
Gene: ENSMUSG00000023350
AA Change: Q518*

DomainStartEndE-ValueType
PHD 7 54 1.5e-8 SMART
JmjC 195 351 1.38e-46 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in 4921501E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:4921501E09Rik APN 17 33065863 missense probably benign 0.10
IGL00790:4921501E09Rik APN 17 33067387 missense probably damaging 1.00
IGL01146:4921501E09Rik APN 17 33065383 missense possibly damaging 0.68
IGL01755:4921501E09Rik APN 17 33066977 missense probably damaging 0.99
IGL01880:4921501E09Rik APN 17 33066716 missense probably damaging 0.99
IGL01981:4921501E09Rik APN 17 33067654 missense probably damaging 1.00
IGL01982:4921501E09Rik APN 17 33066315 missense probably benign 0.00
IGL02047:4921501E09Rik APN 17 33067301 missense probably damaging 1.00
IGL02070:4921501E09Rik APN 17 33066130 missense probably damaging 0.98
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0893:4921501E09Rik UTSW 17 33065289 missense probably benign 0.34
R1528:4921501E09Rik UTSW 17 33067241 missense probably damaging 1.00
R1558:4921501E09Rik UTSW 17 33065705 missense probably benign 0.20
R1664:4921501E09Rik UTSW 17 33066518 missense probably damaging 1.00
R1782:4921501E09Rik UTSW 17 33067688 missense probably benign 0.06
R1881:4921501E09Rik UTSW 17 33065284 missense probably damaging 1.00
R2018:4921501E09Rik UTSW 17 33066967 missense probably benign 0.15
R2029:4921501E09Rik UTSW 17 33067624 nonsense probably null
R2152:4921501E09Rik UTSW 17 33066934 missense probably damaging 1.00
R2298:4921501E09Rik UTSW 17 33066778 missense probably damaging 1.00
R2395:4921501E09Rik UTSW 17 33065962 missense probably benign 0.28
R2424:4921501E09Rik UTSW 17 33065756 missense probably benign 0.00
R3973:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R3976:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R4159:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4160:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4161:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4761:4921501E09Rik UTSW 17 33067198 missense probably damaging 1.00
R4855:4921501E09Rik UTSW 17 33066739 missense probably benign 0.00
R5039:4921501E09Rik UTSW 17 33067760 missense probably damaging 1.00
R5255:4921501E09Rik UTSW 17 33066765 nonsense probably null
R5383:4921501E09Rik UTSW 17 33065257 missense probably benign
R5520:4921501E09Rik UTSW 17 33065393 missense probably benign 0.03
R5685:4921501E09Rik UTSW 17 33066772 missense probably benign 0.04
R5826:4921501E09Rik UTSW 17 33065314 missense possibly damaging 0.87
R5907:4921501E09Rik UTSW 17 33066150 missense probably benign 0.01
R6397:4921501E09Rik UTSW 17 33066245 missense probably benign 0.28
R6731:4921501E09Rik UTSW 17 33066226 missense probably benign 0.02
R6750:4921501E09Rik UTSW 17 33066398 missense possibly damaging 0.82
R7043:4921501E09Rik UTSW 17 33065332 missense possibly damaging 0.85
R7242:4921501E09Rik UTSW 17 33067127 missense probably damaging 1.00
R7262:4921501E09Rik UTSW 17 33066997 missense probably damaging 0.99
R7265:4921501E09Rik UTSW 17 33066997 missense probably damaging 0.99
R7286:4921501E09Rik UTSW 17 33065527 missense probably benign
R7797:4921501E09Rik UTSW 17 33067690 missense probably damaging 1.00
R8314:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8315:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8376:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8377:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8378:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8404:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8405:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8406:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8425:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8501:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8502:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
Z1176:4921501E09Rik UTSW 17 33065657 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGATTCGGACAAGCTCTTTTCC -3'
(R):5'- ACCTTTAAGTTCCAGCAGCTCC -3'

Sequencing Primer
(F):5'- GTATTGCCATTAGCCATCAACAGAGG -3'
(R):5'- TTAAGTTCCAGCAGCTCCATACC -3'
Posted On2016-10-26