Incidental Mutation 'R5588:Rfx2'
ID438922
Institutional Source Beutler Lab
Gene Symbol Rfx2
Ensembl Gene ENSMUSG00000024206
Gene Nameregulatory factor X, 2 (influences HLA class II expression)
Synonyms5430432H19Rik
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.706) question?
Stock #R5588 (G1)
Quality Score173
Status Not validated
Chromosome17
Chromosomal Location56775897-56831008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56779890 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 612 (S612T)
Ref Sequence ENSEMBL: ENSMUSP00000002444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002444
AA Change: S612T

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: S612T

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000086801
AA Change: S587T

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: S587T

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Rfx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Rfx2 APN 17 56783657 missense probably damaging 1.00
IGL01296:Rfx2 APN 17 56808317 start codon destroyed possibly damaging 0.81
IGL01488:Rfx2 APN 17 56805398 missense probably damaging 1.00
IGL01705:Rfx2 APN 17 56785303 missense possibly damaging 0.88
IGL02389:Rfx2 APN 17 56808325 splice site probably benign
IGL02601:Rfx2 APN 17 56785354 missense possibly damaging 0.75
IGL02609:Rfx2 APN 17 56805404 missense probably benign 0.00
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0197:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R0370:Rfx2 UTSW 17 56799308 missense probably benign 0.03
R0413:Rfx2 UTSW 17 56784418 splice site probably benign
R0622:Rfx2 UTSW 17 56777071 missense probably damaging 0.99
R0883:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R1429:Rfx2 UTSW 17 56804369 missense probably damaging 0.97
R1439:Rfx2 UTSW 17 56787720 missense probably damaging 1.00
R1569:Rfx2 UTSW 17 56804326 missense possibly damaging 0.63
R1654:Rfx2 UTSW 17 56808263 missense probably benign 0.00
R1751:Rfx2 UTSW 17 56784754 missense probably benign 0.01
R1816:Rfx2 UTSW 17 56808305 nonsense probably null
R2282:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R3408:Rfx2 UTSW 17 56803526 missense probably benign 0.00
R3962:Rfx2 UTSW 17 56785302 missense probably damaging 0.99
R4415:Rfx2 UTSW 17 56787733 missense possibly damaging 0.95
R4876:Rfx2 UTSW 17 56784706 missense probably benign 0.00
R4883:Rfx2 UTSW 17 56783747 missense probably damaging 0.98
R5766:Rfx2 UTSW 17 56803587 missense probably benign 0.02
R5798:Rfx2 UTSW 17 56804362 missense possibly damaging 0.89
R5931:Rfx2 UTSW 17 56780778 missense probably damaging 0.99
R6061:Rfx2 UTSW 17 56777473 missense possibly damaging 0.86
R6466:Rfx2 UTSW 17 56784397 missense probably benign 0.13
R6800:Rfx2 UTSW 17 56780804 missense probably damaging 0.99
R7329:Rfx2 UTSW 17 56803681 missense probably benign 0.05
R7476:Rfx2 UTSW 17 56803527 missense probably benign 0.31
R8159:Rfx2 UTSW 17 56803605 missense probably benign 0.43
R8274:Rfx2 UTSW 17 56804348 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTTGGTAGCTCCTGCATCTC -3'
(R):5'- ACTGTGAGTCTGTGAAGCTC -3'

Sequencing Primer
(F):5'- CATCTCTGTCTGAGGCCATGG -3'
(R):5'- TCATCTCAGCAGTTGGAAGC -3'
Posted On2016-10-26