Incidental Mutation 'R5588:Cyp2c66'
ID438926
Institutional Source Beutler Lab
Gene Symbol Cyp2c66
Ensembl Gene ENSMUSG00000067229
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location39113898-39187072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39163414 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 191 (D191G)
Ref Sequence ENSEMBL: ENSMUSP00000084487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087234] [ENSMUST00000146494]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087234
AA Change: D191G

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084487
Gene: ENSMUSG00000067229
AA Change: D191G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146494
SMART Domains Protein: ENSMUSP00000120397
Gene: ENSMUSG00000067229

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1cpt__ 26 55 4e-9 SMART
Meta Mutation Damage Score 0.6218 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Cyp2c66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Cyp2c66 APN 19 39170961 missense probably benign 0.00
IGL01589:Cyp2c66 APN 19 39183935 critical splice donor site probably null
IGL02098:Cyp2c66 APN 19 39171029 missense probably damaging 1.00
IGL02114:Cyp2c66 APN 19 39171075 splice site probably benign
IGL02567:Cyp2c66 APN 19 39186640 utr 3 prime probably benign
IGL03181:Cyp2c66 APN 19 39142039 missense probably benign 0.00
IGL03230:Cyp2c66 APN 19 39183858 missense possibly damaging 0.91
R0007:Cyp2c66 UTSW 19 39170958 nonsense probably null
R0092:Cyp2c66 UTSW 19 39183780 splice site probably benign
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0324:Cyp2c66 UTSW 19 39176691 missense probably benign 0.27
R0675:Cyp2c66 UTSW 19 39186616 missense possibly damaging 0.93
R1127:Cyp2c66 UTSW 19 39163368 missense probably damaging 1.00
R1871:Cyp2c66 UTSW 19 39163414 missense possibly damaging 0.66
R3404:Cyp2c66 UTSW 19 39163327 missense probably benign
R3429:Cyp2c66 UTSW 19 39163448 missense probably damaging 0.97
R3896:Cyp2c66 UTSW 19 39142278 missense possibly damaging 0.82
R4115:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4116:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4667:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4668:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4711:Cyp2c66 UTSW 19 39163399 missense possibly damaging 0.74
R4960:Cyp2c66 UTSW 19 39163322 critical splice acceptor site probably null
R5070:Cyp2c66 UTSW 19 39163470 missense probably benign 0.15
R5113:Cyp2c66 UTSW 19 39163438 missense probably benign 0.00
R5125:Cyp2c66 UTSW 19 39171029 missense probably damaging 1.00
R5178:Cyp2c66 UTSW 19 39171029 missense probably damaging 1.00
R6011:Cyp2c66 UTSW 19 39141936 missense probably benign 0.00
R6497:Cyp2c66 UTSW 19 39163377 missense probably damaging 0.96
R6707:Cyp2c66 UTSW 19 39186500 missense probably damaging 1.00
R7173:Cyp2c66 UTSW 19 39170957 missense probably benign 0.01
R7202:Cyp2c66 UTSW 19 39141904 missense probably damaging 1.00
R7469:Cyp2c66 UTSW 19 39183863 missense probably damaging 1.00
R7614:Cyp2c66 UTSW 19 39171028 missense probably damaging 0.98
R7985:Cyp2c66 UTSW 19 39113986 missense probably null 1.00
R8012:Cyp2c66 UTSW 19 39183925 missense probably damaging 1.00
R8056:Cyp2c66 UTSW 19 39142041 missense probably benign 0.00
R8302:Cyp2c66 UTSW 19 39176634 missense probably damaging 1.00
R8329:Cyp2c66 UTSW 19 39186462 nonsense probably null
R8365:Cyp2c66 UTSW 19 39176604 missense probably benign 0.00
R8502:Cyp2c66 UTSW 19 39142329 missense probably benign 0.01
Z1177:Cyp2c66 UTSW 19 39186626 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCATGTGTGGGCAAGACTTG -3'
(R):5'- AGTGAACAGTGTTCTAACAGCC -3'

Sequencing Primer
(F):5'- CAAGACTTGCTTAAATTGTGACCAG -3'
(R):5'- AACAGTGTTCTAACAGCCTTCATTTC -3'
Posted On2016-10-26