Incidental Mutation 'R5599:Olfr1160'
ID438934
Institutional Source Beutler Lab
Gene Symbol Olfr1160
Ensembl Gene ENSMUSG00000075141
Gene Nameolfactory receptor 1160
SynonymsMOR173-1, GA_x6K02T2Q125-49498697-49497765
MMRRC Submission 043151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5599 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88000927-88008268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88006005 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 258 (I258L)
Ref Sequence ENSEMBL: ENSMUSP00000097427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099839] [ENSMUST00000215457]
Predicted Effect probably benign
Transcript: ENSMUST00000099839
AA Change: I258L

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097427
Gene: ENSMUSG00000075141
AA Change: I258L

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 1.2e-46 PFAM
Pfam:7tm_1 50 298 2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215457
AA Change: I249L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,343 N1128D possibly damaging Het
Abhd2 T A 7: 79,296,998 probably null Het
Agpat3 T C 10: 78,274,269 D282G probably benign Het
Ankhd1 G A 18: 36,560,807 A24T probably damaging Het
Cry1 A T 10: 85,144,250 M398K probably benign Het
Dpp10 A G 1: 123,905,076 I47T probably damaging Het
Fam208a A G 14: 27,479,929 N1427D probably benign Het
Fpr-rs6 C T 17: 20,182,113 D329N probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm20767 A C 13: 120,154,922 Q99P probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gxylt1 CTCATCCGGGTCAT CTCAT 15: 93,254,317 probably benign Het
Hnrnpul1 G A 7: 25,754,672 probably benign Het
Lbx1 T A 19: 45,235,080 S50C probably damaging Het
Lims2 A G 18: 31,957,271 N183S probably benign Het
Lrp1 T C 10: 127,593,869 N444S probably damaging Het
Mast4 A T 13: 102,737,479 C1626S probably damaging Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Nf2 T C 11: 4,782,269 E553G probably damaging Het
Nfatc4 A T 14: 55,832,276 T704S probably benign Het
Olfr140 A G 2: 90,052,219 V35A probably benign Het
Olfr679 T C 7: 105,086,550 probably null Het
Olfr847 T G 9: 19,375,629 N84T possibly damaging Het
Plekha7 T A 7: 116,176,882 probably null Het
Polr1a T C 6: 71,967,362 M1271T possibly damaging Het
Ppip5k2 A G 1: 97,740,598 M595T probably damaging Het
Ppox A T 1: 171,277,460 V412D probably damaging Het
Ppp1r12b A G 1: 134,865,907 V573A probably benign Het
Prkcb T C 7: 122,582,478 Y430H probably benign Het
Psmd6 A C 14: 14,120,144 M65R probably benign Het
Rbm12 G A 2: 156,096,793 R520* probably null Het
Rin3 T C 12: 102,389,929 F830L probably damaging Het
Sema4b A G 7: 80,213,291 K104R probably benign Het
Slitrk1 T C 14: 108,911,812 D489G probably benign Het
Spef2 T C 15: 9,729,703 T110A possibly damaging Het
Sult2a6 T A 7: 14,254,704 K44* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tnxb G T 17: 34,690,202 G1445V probably damaging Het
Tnxb T C 17: 34,690,205 V1569A probably benign Het
Zcchc2 A G 1: 106,032,150 D1163G probably damaging Het
Zfp365 C T 10: 67,909,367 E194K probably damaging Het
Other mutations in Olfr1160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Olfr1160 APN 2 88006644 missense probably damaging 1.00
IGL01321:Olfr1160 APN 2 88006245 missense probably damaging 0.97
IGL02009:Olfr1160 APN 2 88006773 missense probably benign
IGL03409:Olfr1160 APN 2 88005895 missense probably damaging 1.00
R0089:Olfr1160 UTSW 2 88005987 missense probably damaging 1.00
R0685:Olfr1160 UTSW 2 88006418 missense probably damaging 1.00
R1416:Olfr1160 UTSW 2 88006571 missense probably damaging 1.00
R1852:Olfr1160 UTSW 2 88006521 missense probably damaging 1.00
R1965:Olfr1160 UTSW 2 88006304 missense probably damaging 1.00
R2206:Olfr1160 UTSW 2 88006235 missense probably benign 0.00
R4853:Olfr1160 UTSW 2 88006104 missense probably damaging 1.00
R6851:Olfr1160 UTSW 2 88005956 missense probably damaging 0.98
R6995:Olfr1160 UTSW 2 88006185 missense probably benign 0.00
R7817:Olfr1160 UTSW 2 88006011 missense probably benign
Z1176:Olfr1160 UTSW 2 88006437 missense probably damaging 0.98
Z31818:Olfr1160 UTSW 2 88005890 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTAATGCTGTAAAGCCCATC -3'
(R):5'- GCTTTGATACCTACACACATGAC -3'

Sequencing Primer
(F):5'- GCTGTAAAGCCCATCGTTAAATAGC -3'
(R):5'- CACACATGACATAATATTGGTGGTG -3'
Posted On2016-10-26