Incidental Mutation 'R5599:Abhd2'
ID438942
Institutional Source Beutler Lab
Gene Symbol Abhd2
Ensembl Gene ENSMUSG00000039202
Gene Nameabhydrolase domain containing 2
SynonymsLABH2, 2210009N18Rik
MMRRC Submission 043151-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R5599 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79273199-79365508 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 79296998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037315]
Predicted Effect probably null
Transcript: ENSMUST00000037315
SMART Domains Protein: ENSMUSP00000038361
Gene: ENSMUSG00000039202

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:Hydrolase_4 124 362 1.1e-10 PFAM
Pfam:Abhydrolase_1 126 383 2.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205557
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a wide range of enzymes. The encoded protein is an acylglycerol lipase that catalyzes the hydrolysis of endocannabinoid arachidonoylglycerol from the cell membrane. This leads to activation of the sperm calcium channel CatSper, which results in sperm activation. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele are overtly but exhibit enhanced migratory ability of cultured smooth muscle cells, and significant intimal hyperplasia after cuff placement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,343 N1128D possibly damaging Het
Agpat3 T C 10: 78,274,269 D282G probably benign Het
Ankhd1 G A 18: 36,560,807 A24T probably damaging Het
Cry1 A T 10: 85,144,250 M398K probably benign Het
Dpp10 A G 1: 123,905,076 I47T probably damaging Het
Fam208a A G 14: 27,479,929 N1427D probably benign Het
Fpr-rs6 C T 17: 20,182,113 D329N probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm20767 A C 13: 120,154,922 Q99P probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gxylt1 CTCATCCGGGTCAT CTCAT 15: 93,254,317 probably benign Het
Hnrnpul1 G A 7: 25,754,672 probably benign Het
Lbx1 T A 19: 45,235,080 S50C probably damaging Het
Lims2 A G 18: 31,957,271 N183S probably benign Het
Lrp1 T C 10: 127,593,869 N444S probably damaging Het
Mast4 A T 13: 102,737,479 C1626S probably damaging Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Nf2 T C 11: 4,782,269 E553G probably damaging Het
Nfatc4 A T 14: 55,832,276 T704S probably benign Het
Olfr1160 T G 2: 88,006,005 I258L probably benign Het
Olfr140 A G 2: 90,052,219 V35A probably benign Het
Olfr679 T C 7: 105,086,550 probably null Het
Olfr847 T G 9: 19,375,629 N84T possibly damaging Het
Plekha7 T A 7: 116,176,882 probably null Het
Polr1a T C 6: 71,967,362 M1271T possibly damaging Het
Ppip5k2 A G 1: 97,740,598 M595T probably damaging Het
Ppox A T 1: 171,277,460 V412D probably damaging Het
Ppp1r12b A G 1: 134,865,907 V573A probably benign Het
Prkcb T C 7: 122,582,478 Y430H probably benign Het
Psmd6 A C 14: 14,120,144 M65R probably benign Het
Rbm12 G A 2: 156,096,793 R520* probably null Het
Rin3 T C 12: 102,389,929 F830L probably damaging Het
Sema4b A G 7: 80,213,291 K104R probably benign Het
Slitrk1 T C 14: 108,911,812 D489G probably benign Het
Spef2 T C 15: 9,729,703 T110A possibly damaging Het
Sult2a6 T A 7: 14,254,704 K44* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tnxb G T 17: 34,690,202 G1445V probably damaging Het
Tnxb T C 17: 34,690,205 V1569A probably benign Het
Zcchc2 A G 1: 106,032,150 D1163G probably damaging Het
Zfp365 C T 10: 67,909,367 E194K probably damaging Het
Other mutations in Abhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Abhd2 APN 7 79325452 missense possibly damaging 0.91
IGL03067:Abhd2 APN 7 79360034 missense probably benign
R0363:Abhd2 UTSW 7 79350813 missense possibly damaging 0.81
R1587:Abhd2 UTSW 7 79354010 missense probably benign 0.01
R1921:Abhd2 UTSW 7 79348356 missense possibly damaging 0.83
R3108:Abhd2 UTSW 7 79323585 missense probably benign 0.01
R4374:Abhd2 UTSW 7 79323530 missense probably benign 0.00
R4621:Abhd2 UTSW 7 79325487 missense probably damaging 1.00
R4763:Abhd2 UTSW 7 79360131 missense probably benign 0.00
R5217:Abhd2 UTSW 7 79323630 missense probably benign
R6972:Abhd2 UTSW 7 79354027 missense probably benign 0.02
R7617:Abhd2 UTSW 7 79348284 missense probably benign 0.10
R8062:Abhd2 UTSW 7 79325590 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGCACTTTAGAACTGTTTTCCTGG -3'
(R):5'- AGGCAGGACAGTGAACTCAC -3'

Sequencing Primer
(F):5'- ACTTTAGAACTGTTTTCCTGGTGATG -3'
(R):5'- CTCACTCTTTGGTCAGAAGAGGAC -3'
Posted On2016-10-26