Incidental Mutation 'R5599:Sema4b'
ID438943
Institutional Source Beutler Lab
Gene Symbol Sema4b
Ensembl Gene ENSMUSG00000030539
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
SynonymsSemac, SemC
MMRRC Submission 043151-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R5599 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80186841-80226527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80213291 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 104 (K104R)
Ref Sequence ENSEMBL: ENSMUSP00000145622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032754] [ENSMUST00000205822]
Predicted Effect probably benign
Transcript: ENSMUST00000032754
AA Change: K104R

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032754
Gene: ENSMUSG00000030539
AA Change: K104R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 582 4.7e-9 SMART
low complexity region 626 639 N/A INTRINSIC
transmembrane domain 701 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107383
SMART Domains Protein: ENSMUSP00000103006
Gene: ENSMUSG00000030539

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 550 2.68e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123023
Predicted Effect probably benign
Transcript: ENSMUST00000205822
AA Change: K104R

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206885
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal cerebellar morphology. Mice homozygous for a knock-out allele exhibit enhanced memory response by way of increased IgE and IgG1 serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,343 N1128D possibly damaging Het
Abhd2 T A 7: 79,296,998 probably null Het
Agpat3 T C 10: 78,274,269 D282G probably benign Het
Ankhd1 G A 18: 36,560,807 A24T probably damaging Het
Cry1 A T 10: 85,144,250 M398K probably benign Het
Dpp10 A G 1: 123,905,076 I47T probably damaging Het
Fam208a A G 14: 27,479,929 N1427D probably benign Het
Fpr-rs6 C T 17: 20,182,113 D329N probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm20767 A C 13: 120,154,922 Q99P probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gxylt1 CTCATCCGGGTCAT CTCAT 15: 93,254,317 probably benign Het
Hnrnpul1 G A 7: 25,754,672 probably benign Het
Lbx1 T A 19: 45,235,080 S50C probably damaging Het
Lims2 A G 18: 31,957,271 N183S probably benign Het
Lrp1 T C 10: 127,593,869 N444S probably damaging Het
Mast4 A T 13: 102,737,479 C1626S probably damaging Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Nf2 T C 11: 4,782,269 E553G probably damaging Het
Nfatc4 A T 14: 55,832,276 T704S probably benign Het
Olfr1160 T G 2: 88,006,005 I258L probably benign Het
Olfr140 A G 2: 90,052,219 V35A probably benign Het
Olfr679 T C 7: 105,086,550 probably null Het
Olfr847 T G 9: 19,375,629 N84T possibly damaging Het
Plekha7 T A 7: 116,176,882 probably null Het
Polr1a T C 6: 71,967,362 M1271T possibly damaging Het
Ppip5k2 A G 1: 97,740,598 M595T probably damaging Het
Ppox A T 1: 171,277,460 V412D probably damaging Het
Ppp1r12b A G 1: 134,865,907 V573A probably benign Het
Prkcb T C 7: 122,582,478 Y430H probably benign Het
Psmd6 A C 14: 14,120,144 M65R probably benign Het
Rbm12 G A 2: 156,096,793 R520* probably null Het
Rin3 T C 12: 102,389,929 F830L probably damaging Het
Slitrk1 T C 14: 108,911,812 D489G probably benign Het
Spef2 T C 15: 9,729,703 T110A possibly damaging Het
Sult2a6 T A 7: 14,254,704 K44* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tnxb G T 17: 34,690,202 G1445V probably damaging Het
Tnxb T C 17: 34,690,205 V1569A probably benign Het
Zcchc2 A G 1: 106,032,150 D1163G probably damaging Het
Zfp365 C T 10: 67,909,367 E194K probably damaging Het
Other mutations in Sema4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Sema4b APN 7 80215696 missense probably damaging 1.00
IGL02584:Sema4b APN 7 80224988 missense probably benign
IGL02657:Sema4b APN 7 80217041 missense probably damaging 1.00
false_flag UTSW 7 80198654 start codon destroyed probably null
R0114:Sema4b UTSW 7 80219078 splice site probably benign
R0480:Sema4b UTSW 7 80220206 missense probably damaging 1.00
R1184:Sema4b UTSW 7 80224640 missense probably benign 0.27
R1545:Sema4b UTSW 7 80219023 missense probably benign 0.02
R1687:Sema4b UTSW 7 80219262 missense probably damaging 1.00
R1880:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R1881:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R2180:Sema4b UTSW 7 80212835 missense probably benign 0.28
R2352:Sema4b UTSW 7 80220879 missense probably damaging 0.99
R2424:Sema4b UTSW 7 80219275 missense probably damaging 1.00
R3913:Sema4b UTSW 7 80220474 missense probably benign
R4353:Sema4b UTSW 7 80215651 missense probably damaging 1.00
R4757:Sema4b UTSW 7 80216829 missense probably damaging 1.00
R4921:Sema4b UTSW 7 80198756 missense possibly damaging 0.77
R5004:Sema4b UTSW 7 80216345 missense probably benign 0.13
R5399:Sema4b UTSW 7 80224886 missense probably benign
R5820:Sema4b UTSW 7 80224958 missense probably damaging 0.99
R5840:Sema4b UTSW 7 80218949 missense probably damaging 1.00
R5901:Sema4b UTSW 7 80224967 missense possibly damaging 0.49
R6600:Sema4b UTSW 7 80212928 missense probably benign 0.42
R6749:Sema4b UTSW 7 80220201 missense possibly damaging 0.56
R6992:Sema4b UTSW 7 80220152 missense probably damaging 0.97
R7175:Sema4b UTSW 7 80198654 start codon destroyed probably null
R7660:Sema4b UTSW 7 80220247 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAACCTCAGCTTCTTGCC -3'
(R):5'- TGCTAACGCTAATGGGACAGG -3'

Sequencing Primer
(F):5'- TCAGCTTCTTGCCAGGCG -3'
(R):5'- TCCAGGGATATAGGCATACTATTCCC -3'
Posted On2016-10-26