Incidental Mutation 'R5599:Olfr847'
ID438947
Institutional Source Beutler Lab
Gene Symbol Olfr847
Ensembl Gene ENSMUSG00000059821
Gene Nameolfactory receptor 847
SynonymsMOR149-2, GA_x6K02T2PVTD-13113073-13112135
MMRRC Submission 043151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R5599 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19373668-19378669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 19375629 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 84 (N84T)
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079620
AA Change: N84T

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821
AA Change: N84T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212306
AA Change: N84T
Predicted Effect possibly damaging
Transcript: ENSMUST00000216839
AA Change: N84T

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,343 N1128D possibly damaging Het
Abhd2 T A 7: 79,296,998 probably null Het
Agpat3 T C 10: 78,274,269 D282G probably benign Het
Ankhd1 G A 18: 36,560,807 A24T probably damaging Het
Cry1 A T 10: 85,144,250 M398K probably benign Het
Dpp10 A G 1: 123,905,076 I47T probably damaging Het
Fam208a A G 14: 27,479,929 N1427D probably benign Het
Fpr-rs6 C T 17: 20,182,113 D329N probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm20767 A C 13: 120,154,922 Q99P probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gxylt1 CTCATCCGGGTCAT CTCAT 15: 93,254,317 probably benign Het
Hnrnpul1 G A 7: 25,754,672 probably benign Het
Lbx1 T A 19: 45,235,080 S50C probably damaging Het
Lims2 A G 18: 31,957,271 N183S probably benign Het
Lrp1 T C 10: 127,593,869 N444S probably damaging Het
Mast4 A T 13: 102,737,479 C1626S probably damaging Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Nf2 T C 11: 4,782,269 E553G probably damaging Het
Nfatc4 A T 14: 55,832,276 T704S probably benign Het
Olfr1160 T G 2: 88,006,005 I258L probably benign Het
Olfr140 A G 2: 90,052,219 V35A probably benign Het
Olfr679 T C 7: 105,086,550 probably null Het
Plekha7 T A 7: 116,176,882 probably null Het
Polr1a T C 6: 71,967,362 M1271T possibly damaging Het
Ppip5k2 A G 1: 97,740,598 M595T probably damaging Het
Ppox A T 1: 171,277,460 V412D probably damaging Het
Ppp1r12b A G 1: 134,865,907 V573A probably benign Het
Prkcb T C 7: 122,582,478 Y430H probably benign Het
Psmd6 A C 14: 14,120,144 M65R probably benign Het
Rbm12 G A 2: 156,096,793 R520* probably null Het
Rin3 T C 12: 102,389,929 F830L probably damaging Het
Sema4b A G 7: 80,213,291 K104R probably benign Het
Slitrk1 T C 14: 108,911,812 D489G probably benign Het
Spef2 T C 15: 9,729,703 T110A possibly damaging Het
Sult2a6 T A 7: 14,254,704 K44* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tnxb G T 17: 34,690,202 G1445V probably damaging Het
Tnxb T C 17: 34,690,205 V1569A probably benign Het
Zcchc2 A G 1: 106,032,150 D1163G probably damaging Het
Zfp365 C T 10: 67,909,367 E194K probably damaging Het
Other mutations in Olfr847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Olfr847 APN 9 19375239 missense probably damaging 1.00
IGL01293:Olfr847 APN 9 19375336 missense probably benign 0.23
IGL01879:Olfr847 APN 9 19375407 nonsense probably null
IGL03298:Olfr847 APN 9 19375062 missense probably damaging 1.00
R1350:Olfr847 UTSW 9 19375414 missense possibly damaging 0.94
R1400:Olfr847 UTSW 9 19375062 missense probably damaging 0.98
R2894:Olfr847 UTSW 9 19375292 nonsense probably null
R4468:Olfr847 UTSW 9 19375648 missense probably benign 0.00
R4694:Olfr847 UTSW 9 19375398 missense probably damaging 1.00
R4791:Olfr847 UTSW 9 19375809 missense probably benign 0.28
R4794:Olfr847 UTSW 9 19375545 missense probably benign 0.00
R5517:Olfr847 UTSW 9 19375767 missense probably damaging 1.00
R5777:Olfr847 UTSW 9 19375718 missense probably benign 0.29
R6505:Olfr847 UTSW 9 19374941 makesense probably null
R6509:Olfr847 UTSW 9 19375143 missense probably benign
R7246:Olfr847 UTSW 9 19375465 nonsense probably null
R7659:Olfr847 UTSW 9 19375558 missense probably benign 0.03
R7789:Olfr847 UTSW 9 19375065 missense probably benign 0.33
R7886:Olfr847 UTSW 9 19375906 splice site probably null
R7969:Olfr847 UTSW 9 19375906 splice site probably null
Z1088:Olfr847 UTSW 9 19375684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGTGCTAATGATCAAGGAC -3'
(R):5'- CTACAGTAGAGCCCCTCATCTTTG -3'

Sequencing Primer
(F):5'- TCAGCAAACCACAGAATTGGG -3'
(R):5'- TGGCTTCTTTATGTTTACATATCTGG -3'
Posted On2016-10-26