Incidental Mutation 'R5599:Slitrk1'
ID438960
Institutional Source Beutler Lab
Gene Symbol Slitrk1
Ensembl Gene ENSMUSG00000075478
Gene NameSLIT and NTRK-like family, member 1
Synonyms3200001I04Rik
MMRRC Submission 043151-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5599 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location108908800-108914158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108911812 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 489 (D489G)
Ref Sequence ENSEMBL: ENSMUSP00000097897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100322]
Predicted Effect probably benign
Transcript: ENSMUST00000100322
AA Change: D489G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097897
Gene: ENSMUSG00000075478
AA Change: D489G

DomainStartEndE-ValueType
LRR 81 104 1.37e2 SMART
LRR 105 128 1.37e1 SMART
LRR 129 152 4.57e0 SMART
LRR_TYP 153 176 2.75e-3 SMART
LRR 180 200 1.92e2 SMART
LRRCT 212 262 3.45e-5 SMART
LRRNT 340 376 4.28e0 SMART
LRR 374 397 1.86e1 SMART
LRR 398 421 1.49e1 SMART
LRR 422 445 2.68e1 SMART
LRR 446 469 4.98e-1 SMART
LRR_TYP 470 493 6.52e-5 SMART
LRR 494 517 3.46e2 SMART
LRRCT 529 579 3.91e-4 SMART
transmembrane domain 621 643 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. However, the protein encoded by this gene lacks the region of homology to neurotrophin receptors. This protein is thought to be involved in neurite outgrowth. Mutations in this gene may be associated with Tourette syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display hypoactivity, reduced male body weight, elevated anxiety- and depression-like behavior, increased norepinephrine content in brain, and partial postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,343 N1128D possibly damaging Het
Abhd2 T A 7: 79,296,998 probably null Het
Agpat3 T C 10: 78,274,269 D282G probably benign Het
Ankhd1 G A 18: 36,560,807 A24T probably damaging Het
Cry1 A T 10: 85,144,250 M398K probably benign Het
Dpp10 A G 1: 123,905,076 I47T probably damaging Het
Fam208a A G 14: 27,479,929 N1427D probably benign Het
Fpr-rs6 C T 17: 20,182,113 D329N probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm20767 A C 13: 120,154,922 Q99P probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gxylt1 CTCATCCGGGTCAT CTCAT 15: 93,254,317 probably benign Het
Hnrnpul1 G A 7: 25,754,672 probably benign Het
Lbx1 T A 19: 45,235,080 S50C probably damaging Het
Lims2 A G 18: 31,957,271 N183S probably benign Het
Lrp1 T C 10: 127,593,869 N444S probably damaging Het
Mast4 A T 13: 102,737,479 C1626S probably damaging Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Nf2 T C 11: 4,782,269 E553G probably damaging Het
Nfatc4 A T 14: 55,832,276 T704S probably benign Het
Olfr1160 T G 2: 88,006,005 I258L probably benign Het
Olfr140 A G 2: 90,052,219 V35A probably benign Het
Olfr679 T C 7: 105,086,550 probably null Het
Olfr847 T G 9: 19,375,629 N84T possibly damaging Het
Plekha7 T A 7: 116,176,882 probably null Het
Polr1a T C 6: 71,967,362 M1271T possibly damaging Het
Ppip5k2 A G 1: 97,740,598 M595T probably damaging Het
Ppox A T 1: 171,277,460 V412D probably damaging Het
Ppp1r12b A G 1: 134,865,907 V573A probably benign Het
Prkcb T C 7: 122,582,478 Y430H probably benign Het
Psmd6 A C 14: 14,120,144 M65R probably benign Het
Rbm12 G A 2: 156,096,793 R520* probably null Het
Rin3 T C 12: 102,389,929 F830L probably damaging Het
Sema4b A G 7: 80,213,291 K104R probably benign Het
Spef2 T C 15: 9,729,703 T110A possibly damaging Het
Sult2a6 T A 7: 14,254,704 K44* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tnxb G T 17: 34,690,202 G1445V probably damaging Het
Tnxb T C 17: 34,690,205 V1569A probably benign Het
Zcchc2 A G 1: 106,032,150 D1163G probably damaging Het
Zfp365 C T 10: 67,909,367 E194K probably damaging Het
Other mutations in Slitrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Slitrk1 APN 14 108911837 missense probably damaging 1.00
IGL00949:Slitrk1 APN 14 108911809 missense probably damaging 0.98
IGL01556:Slitrk1 APN 14 108913018 missense probably damaging 1.00
IGL01924:Slitrk1 APN 14 108911239 missense probably benign 0.08
IGL02389:Slitrk1 APN 14 108912322 missense probably benign
IGL02619:Slitrk1 APN 14 108911917 missense probably benign 0.09
IGL02828:Slitrk1 APN 14 108911616 missense possibly damaging 0.63
R0070:Slitrk1 UTSW 14 108913317 start gained probably benign
R0135:Slitrk1 UTSW 14 108911629 missense probably benign 0.00
R0627:Slitrk1 UTSW 14 108912239 missense probably damaging 1.00
R1529:Slitrk1 UTSW 14 108913277 start codon destroyed probably benign 0.33
R1661:Slitrk1 UTSW 14 108911927 missense probably damaging 1.00
R1711:Slitrk1 UTSW 14 108913096 missense probably benign 0.21
R1960:Slitrk1 UTSW 14 108912190 missense probably damaging 0.96
R1961:Slitrk1 UTSW 14 108912190 missense probably damaging 0.96
R4247:Slitrk1 UTSW 14 108912562 missense possibly damaging 0.95
R4394:Slitrk1 UTSW 14 108911303 missense probably benign 0.01
R5027:Slitrk1 UTSW 14 108912308 missense probably benign
R5241:Slitrk1 UTSW 14 108913012 missense probably benign 0.27
R5835:Slitrk1 UTSW 14 108911572 missense possibly damaging 0.94
R6224:Slitrk1 UTSW 14 108912022 missense probably damaging 1.00
R6489:Slitrk1 UTSW 14 108911303 missense possibly damaging 0.63
R6504:Slitrk1 UTSW 14 108911697 missense probably benign 0.14
R7102:Slitrk1 UTSW 14 108912629 missense probably benign 0.01
R7346:Slitrk1 UTSW 14 108913159 missense possibly damaging 0.89
R7413:Slitrk1 UTSW 14 108911925 nonsense probably null
R8005:Slitrk1 UTSW 14 108913265 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CACTTGAGGTCGCTCATCAG -3'
(R):5'- ACCTCAGGTGGCTCTACATG -3'

Sequencing Primer
(F):5'- AGGTCGCTCATCAGCACCTC -3'
(R):5'- GGATAGTAACTACCTGGACACTCTG -3'
Posted On2016-10-26