Incidental Mutation 'R5599:Fpr-rs6'
ID438963
Institutional Source Beutler Lab
Gene Symbol Fpr-rs6
Ensembl Gene ENSMUSG00000071275
Gene Nameformyl peptide receptor, related sequence 6
Synonyms
MMRRC Submission 043151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5599 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20182078-20183097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20182113 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 329 (D329N)
Ref Sequence ENSEMBL: ENSMUSP00000093296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095636]
Predicted Effect probably benign
Transcript: ENSMUST00000095636
AA Change: D329N

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093296
Gene: ENSMUSG00000071275
AA Change: D329N

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 5.7e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,343 N1128D possibly damaging Het
Abhd2 T A 7: 79,296,998 probably null Het
Agpat3 T C 10: 78,274,269 D282G probably benign Het
Ankhd1 G A 18: 36,560,807 A24T probably damaging Het
Cry1 A T 10: 85,144,250 M398K probably benign Het
Dpp10 A G 1: 123,905,076 I47T probably damaging Het
Fam208a A G 14: 27,479,929 N1427D probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm20767 A C 13: 120,154,922 Q99P probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gxylt1 CTCATCCGGGTCAT CTCAT 15: 93,254,317 probably benign Het
Hnrnpul1 G A 7: 25,754,672 probably benign Het
Lbx1 T A 19: 45,235,080 S50C probably damaging Het
Lims2 A G 18: 31,957,271 N183S probably benign Het
Lrp1 T C 10: 127,593,869 N444S probably damaging Het
Mast4 A T 13: 102,737,479 C1626S probably damaging Het
Mgat5 A G 1: 127,397,566 Y390C probably damaging Het
Nf2 T C 11: 4,782,269 E553G probably damaging Het
Nfatc4 A T 14: 55,832,276 T704S probably benign Het
Olfr1160 T G 2: 88,006,005 I258L probably benign Het
Olfr140 A G 2: 90,052,219 V35A probably benign Het
Olfr679 T C 7: 105,086,550 probably null Het
Olfr847 T G 9: 19,375,629 N84T possibly damaging Het
Plekha7 T A 7: 116,176,882 probably null Het
Polr1a T C 6: 71,967,362 M1271T possibly damaging Het
Ppip5k2 A G 1: 97,740,598 M595T probably damaging Het
Ppox A T 1: 171,277,460 V412D probably damaging Het
Ppp1r12b A G 1: 134,865,907 V573A probably benign Het
Prkcb T C 7: 122,582,478 Y430H probably benign Het
Psmd6 A C 14: 14,120,144 M65R probably benign Het
Rbm12 G A 2: 156,096,793 R520* probably null Het
Rin3 T C 12: 102,389,929 F830L probably damaging Het
Sema4b A G 7: 80,213,291 K104R probably benign Het
Slitrk1 T C 14: 108,911,812 D489G probably benign Het
Spef2 T C 15: 9,729,703 T110A possibly damaging Het
Sult2a6 T A 7: 14,254,704 K44* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tnxb G T 17: 34,690,202 G1445V probably damaging Het
Tnxb T C 17: 34,690,205 V1569A probably benign Het
Zcchc2 A G 1: 106,032,150 D1163G probably damaging Het
Zfp365 C T 10: 67,909,367 E194K probably damaging Het
Other mutations in Fpr-rs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Fpr-rs6 APN 17 20183045 missense probably benign 0.30
IGL03380:Fpr-rs6 APN 17 20182983 missense possibly damaging 0.66
R0149:Fpr-rs6 UTSW 17 20182213 missense probably benign 0.29
R0190:Fpr-rs6 UTSW 17 20182479 missense probably benign 0.07
R1347:Fpr-rs6 UTSW 17 20182749 missense probably benign 0.23
R1347:Fpr-rs6 UTSW 17 20182749 missense probably benign 0.23
R1934:Fpr-rs6 UTSW 17 20182890 missense probably benign 0.36
R1965:Fpr-rs6 UTSW 17 20182656 missense probably damaging 0.98
R3690:Fpr-rs6 UTSW 17 20182875 missense probably benign 0.02
R3963:Fpr-rs6 UTSW 17 20182217 missense probably damaging 1.00
R4564:Fpr-rs6 UTSW 17 20182906 nonsense probably null
R4574:Fpr-rs6 UTSW 17 20183097 start codon destroyed probably damaging 1.00
R5015:Fpr-rs6 UTSW 17 20182346 missense probably damaging 1.00
R6737:Fpr-rs6 UTSW 17 20183077 missense probably benign 0.08
R6786:Fpr-rs6 UTSW 17 20182838 missense possibly damaging 0.95
R6908:Fpr-rs6 UTSW 17 20182439 missense probably damaging 1.00
R7040:Fpr-rs6 UTSW 17 20182934 missense probably damaging 1.00
R7462:Fpr-rs6 UTSW 17 20182223 missense probably damaging 1.00
R7673:Fpr-rs6 UTSW 17 20182737 missense probably benign 0.03
R8103:Fpr-rs6 UTSW 17 20182577 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTCTGGACTCAGCTAAAATCTACC -3'
(R):5'- CACAGAATAATATTGACACGTGGG -3'

Sequencing Primer
(F):5'- AGCTAAAATCTACCAAAATAGGACTG -3'
(R):5'- GGTGAACACAGCAAGCACTCTG -3'
Posted On2016-10-26