Incidental Mutation 'R5599:Ankhd1'
ID 438967
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Name ankyrin repeat and KH domain containing 1
Synonyms A530027J04Rik, 9130019P20Rik, 4933432B13Rik, 1110004O12Rik
MMRRC Submission 043151-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5599 (G1)
Quality Score 130
Status Not validated
Chromosome 18
Chromosomal Location 36693656-36791961 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 36693860 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 24 (A24T)
Ref Sequence ENSEMBL: ENSMUSP00000120290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
AlphaFold E9PUR0
Predicted Effect probably damaging
Transcript: ENSMUST00000006205
AA Change: A24T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: A24T

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134146
SMART Domains Protein: ENSMUSP00000122136
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
ANK 140 169 2.11e2 SMART
ANK 173 202 3.31e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142977
AA Change: A24T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: A24T

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155329
AA Change: A24T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: A24T

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T A 7: 78,946,746 (GRCm39) probably null Het
Agpat3 T C 10: 78,110,103 (GRCm39) D282G probably benign Het
Cracdl T C 1: 37,652,424 (GRCm39) N1128D possibly damaging Het
Cry1 A T 10: 84,980,114 (GRCm39) M398K probably benign Het
Dpp10 A G 1: 123,832,803 (GRCm39) I47T probably damaging Het
Fpr-rs6 C T 17: 20,402,375 (GRCm39) D329N probably benign Het
Gfm2 G A 13: 97,299,659 (GRCm39) A406T probably damaging Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Gxylt1 CTCATCCGGGTCAT CTCAT 15: 93,152,198 (GRCm39) probably benign Het
Hnrnpul1 G A 7: 25,454,097 (GRCm39) probably benign Het
Lbx1 T A 19: 45,223,519 (GRCm39) S50C probably damaging Het
Lims2 A G 18: 32,090,324 (GRCm39) N183S probably benign Het
Lrp1 T C 10: 127,429,738 (GRCm39) N444S probably damaging Het
Mast4 A T 13: 102,873,987 (GRCm39) C1626S probably damaging Het
Mgat5 A G 1: 127,325,303 (GRCm39) Y390C probably damaging Het
Nf2 T C 11: 4,732,269 (GRCm39) E553G probably damaging Het
Nfatc4 A T 14: 56,069,733 (GRCm39) T704S probably benign Het
Or4c3d A G 2: 89,882,563 (GRCm39) V35A probably benign Het
Or56a3 T C 7: 104,735,757 (GRCm39) probably null Het
Or7g29 T G 9: 19,286,925 (GRCm39) N84T possibly damaging Het
Or9m1b T G 2: 87,836,349 (GRCm39) I258L probably benign Het
Plekha7 T A 7: 115,776,117 (GRCm39) probably null Het
Polr1a T C 6: 71,944,346 (GRCm39) M1271T possibly damaging Het
Ppip5k2 A G 1: 97,668,323 (GRCm39) M595T probably damaging Het
Ppox A T 1: 171,105,033 (GRCm39) V412D probably damaging Het
Ppp1r12b A G 1: 134,793,645 (GRCm39) V573A probably benign Het
Prkcb T C 7: 122,181,701 (GRCm39) Y430H probably benign Het
Psmd6 A C 14: 14,120,144 (GRCm38) M65R probably benign Het
Rbm12 G A 2: 155,938,713 (GRCm39) R520* probably null Het
Rin3 T C 12: 102,356,188 (GRCm39) F830L probably damaging Het
Sema4b A G 7: 79,863,039 (GRCm39) K104R probably benign Het
Slitrk1 T C 14: 109,149,244 (GRCm39) D489G probably benign Het
Spef2 T C 15: 9,729,789 (GRCm39) T110A possibly damaging Het
Sult2a6 T A 7: 13,988,629 (GRCm39) K44* probably null Het
Tasor A G 14: 27,201,886 (GRCm39) N1427D probably benign Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Tcstv2c A C 13: 120,616,458 (GRCm39) Q99P probably damaging Het
Tnxb G T 17: 34,909,176 (GRCm39) G1445V probably damaging Het
Tnxb T C 17: 34,909,179 (GRCm39) V1569A probably benign Het
Zcchc2 A G 1: 105,959,880 (GRCm39) D1163G probably damaging Het
Zfp365 C T 10: 67,745,197 (GRCm39) E194K probably damaging Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36,798,512 (GRCm39) unclassified probably benign
IGL00927:Ankhd1 APN 18 36,765,125 (GRCm39) missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36,711,696 (GRCm39) missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36,791,066 (GRCm39) missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36,781,206 (GRCm39) missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36,781,427 (GRCm39) missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36,781,479 (GRCm39) missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36,757,714 (GRCm39) missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36,789,779 (GRCm39) missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36,727,867 (GRCm39) missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36,780,756 (GRCm39) missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36,711,828 (GRCm39) critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36,781,599 (GRCm39) missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36,727,876 (GRCm39) missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36,791,061 (GRCm39) nonsense probably null
IGL03163:Ankhd1 APN 18 36,780,681 (GRCm39) missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36,711,827 (GRCm39) missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36,780,830 (GRCm39) missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36,789,890 (GRCm39) splice site probably benign
FR4304:Ankhd1 UTSW 18 36,693,977 (GRCm39) small insertion probably benign
R0051:Ankhd1 UTSW 18 36,780,241 (GRCm39) unclassified probably benign
R0089:Ankhd1 UTSW 18 36,773,409 (GRCm39) missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36,779,819 (GRCm39) missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36,780,267 (GRCm39) missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36,767,787 (GRCm39) missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36,791,061 (GRCm39) nonsense probably null
R0361:Ankhd1 UTSW 18 36,780,267 (GRCm39) missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36,777,652 (GRCm39) missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36,767,353 (GRCm39) missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36,777,652 (GRCm39) missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36,773,333 (GRCm39) missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36,773,333 (GRCm39) missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36,778,302 (GRCm39) splice site probably benign
R1127:Ankhd1 UTSW 18 36,767,399 (GRCm39) missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36,758,212 (GRCm39) missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36,758,318 (GRCm39) missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36,780,361 (GRCm39) missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36,777,580 (GRCm39) missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36,781,083 (GRCm39) missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36,778,166 (GRCm39) missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36,774,679 (GRCm39) missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36,767,361 (GRCm39) missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36,780,674 (GRCm39) missense probably benign
R2196:Ankhd1 UTSW 18 36,781,432 (GRCm39) missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36,777,386 (GRCm39) missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36,775,979 (GRCm39) missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36,757,818 (GRCm39) missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36,711,596 (GRCm39) splice site probably null
R2958:Ankhd1 UTSW 18 36,767,782 (GRCm39) missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36,780,666 (GRCm39) missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36,780,666 (GRCm39) missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36,722,593 (GRCm39) missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36,794,101 (GRCm39) unclassified probably benign
R4323:Ankhd1 UTSW 18 36,711,686 (GRCm39) missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36,776,096 (GRCm39) nonsense probably null
R4496:Ankhd1 UTSW 18 36,693,839 (GRCm39) missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36,788,560 (GRCm39) splice site probably null
R4590:Ankhd1 UTSW 18 36,716,697 (GRCm39) missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36,781,074 (GRCm39) missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36,711,787 (GRCm39) missense probably null 0.00
R4923:Ankhd1 UTSW 18 36,722,505 (GRCm39) missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36,758,080 (GRCm39) missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36,789,768 (GRCm39) missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36,694,111 (GRCm39) splice site probably null
R5336:Ankhd1 UTSW 18 36,779,769 (GRCm39) missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36,722,461 (GRCm39) missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36,724,548 (GRCm39) missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36,724,548 (GRCm39) missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36,767,697 (GRCm39) missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36,781,538 (GRCm39) missense probably benign 0.01
R5659:Ankhd1 UTSW 18 36,694,103 (GRCm39) missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36,757,955 (GRCm39) missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36,773,322 (GRCm39) missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36,780,577 (GRCm39) missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36,733,887 (GRCm39) missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36,758,179 (GRCm39) missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36,744,862 (GRCm39) missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36,787,199 (GRCm39) missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36,724,509 (GRCm39) missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36,733,836 (GRCm39) splice site probably null
R6653:Ankhd1 UTSW 18 36,733,836 (GRCm39) splice site probably null
R6763:Ankhd1 UTSW 18 36,776,022 (GRCm39) missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36,781,307 (GRCm39) missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36,693,042 (GRCm39) missense
R7208:Ankhd1 UTSW 18 36,758,081 (GRCm39) missense probably benign
R7305:Ankhd1 UTSW 18 36,765,258 (GRCm39) missense
R7615:Ankhd1 UTSW 18 36,789,826 (GRCm39) missense
R7654:Ankhd1 UTSW 18 36,727,154 (GRCm39) missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36,758,258 (GRCm39) missense probably damaging 1.00
R7842:Ankhd1 UTSW 18 36,780,881 (GRCm39) missense probably benign 0.00
R7965:Ankhd1 UTSW 18 36,791,465 (GRCm39) missense
R8006:Ankhd1 UTSW 18 36,781,772 (GRCm39) missense
R8037:Ankhd1 UTSW 18 36,771,676 (GRCm39) missense probably damaging 0.98
R8123:Ankhd1 UTSW 18 36,708,136 (GRCm39) missense
R8195:Ankhd1 UTSW 18 36,787,230 (GRCm39) missense
R8305:Ankhd1 UTSW 18 36,780,219 (GRCm39) missense possibly damaging 0.79
R8708:Ankhd1 UTSW 18 36,727,344 (GRCm39) missense probably damaging 1.00
R8827:Ankhd1 UTSW 18 36,757,633 (GRCm39) nonsense probably null
R9138:Ankhd1 UTSW 18 36,693,961 (GRCm39) small deletion probably benign
R9139:Ankhd1 UTSW 18 36,711,810 (GRCm39) missense
R9186:Ankhd1 UTSW 18 36,767,383 (GRCm39) missense possibly damaging 0.95
R9245:Ankhd1 UTSW 18 36,788,653 (GRCm39) missense
R9254:Ankhd1 UTSW 18 36,777,680 (GRCm39) missense probably benign 0.03
R9262:Ankhd1 UTSW 18 36,765,799 (GRCm39) missense
R9379:Ankhd1 UTSW 18 36,777,680 (GRCm39) missense probably benign 0.03
R9436:Ankhd1 UTSW 18 36,774,654 (GRCm39) missense probably benign 0.04
R9436:Ankhd1 UTSW 18 36,694,041 (GRCm39) missense probably benign 0.39
R9541:Ankhd1 UTSW 18 36,757,697 (GRCm39) missense
R9584:Ankhd1 UTSW 18 36,798,504 (GRCm39) missense probably benign 0.06
R9664:Ankhd1 UTSW 18 36,780,878 (GRCm39) missense probably benign 0.03
RF001:Ankhd1 UTSW 18 36,693,974 (GRCm39) small insertion probably benign
RF004:Ankhd1 UTSW 18 36,693,963 (GRCm39) small insertion probably benign
RF007:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF008:Ankhd1 UTSW 18 36,693,977 (GRCm39) small insertion probably benign
RF009:Ankhd1 UTSW 18 36,693,975 (GRCm39) small insertion probably benign
RF013:Ankhd1 UTSW 18 36,693,979 (GRCm39) small insertion probably benign
RF016:Ankhd1 UTSW 18 36,693,963 (GRCm39) small insertion probably benign
RF016:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF017:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF018:Ankhd1 UTSW 18 36,693,965 (GRCm39) small insertion probably benign
RF026:Ankhd1 UTSW 18 36,693,965 (GRCm39) small insertion probably benign
RF030:Ankhd1 UTSW 18 36,693,980 (GRCm39) small insertion probably benign
RF030:Ankhd1 UTSW 18 36,693,966 (GRCm39) small insertion probably benign
RF039:Ankhd1 UTSW 18 36,693,971 (GRCm39) small insertion probably benign
RF043:Ankhd1 UTSW 18 36,693,970 (GRCm39) small insertion probably benign
RF046:Ankhd1 UTSW 18 36,693,979 (GRCm39) small insertion probably benign
RF047:Ankhd1 UTSW 18 36,693,976 (GRCm39) small insertion probably benign
RF047:Ankhd1 UTSW 18 36,693,970 (GRCm39) small insertion probably benign
RF049:Ankhd1 UTSW 18 36,693,976 (GRCm39) small insertion probably benign
RF050:Ankhd1 UTSW 18 36,693,980 (GRCm39) small insertion probably benign
RF054:Ankhd1 UTSW 18 36,693,982 (GRCm39) small insertion probably benign
RF057:Ankhd1 UTSW 18 36,693,982 (GRCm39) small insertion probably benign
RF060:Ankhd1 UTSW 18 36,693,975 (GRCm39) small insertion probably benign
RF061:Ankhd1 UTSW 18 36,693,974 (GRCm39) small insertion probably benign
RF062:Ankhd1 UTSW 18 36,693,971 (GRCm39) small insertion probably benign
X0027:Ankhd1 UTSW 18 36,757,885 (GRCm39) missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36,711,817 (GRCm39) nonsense probably null
X0066:Ankhd1 UTSW 18 36,779,757 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGATGAGTCTAAGGGGC -3'
(R):5'- AACTTGAAATCCAGCGCTGC -3'

Sequencing Primer
(F):5'- AGAAGTTAGTGGCGCTGC -3'
(R):5'- ATCCAGCGCTGCGTCCC -3'
Posted On 2016-10-26