Mutagenetix > Incidental Mutations

Incidental Mutation 'R5600:Gpr158'

438970

Institutional Source

Beutler Lab

Gene Symbol

Gpr158

Ensembl Gene

ENSMUSG00000045967

Gene Name

G protein-coupled receptor 158

Synonyms

5330427M13Rik

MMRRC Submission

043152-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5600 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21367542-21830547 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21827235 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1049 (T1049A)

Ref Sequence

ENSEMBL: ENSMUSP00000049708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055946]

Predicted Effect

probably benign
Transcript: ENSMUST00000055946
AA Change: T1049A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: T1049A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	110	125	N/A	INTRINSIC
SCOP:d1edmb_	313	359	5e-4	SMART
Blast:EGF	318	365	2e-27	BLAST
Pfam:7tm_3	426	669	1.2e-35	PFAM
low complexity region	840	863	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 97.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apol11b	A	C	15: 77,635,088	M264R	probably damaging	Het
Asprv1	G	T	6: 86,629,062	E297*	probably null	Het
Atp6v1c1	T	C	15: 38,686,863	V234A	probably benign	Het
Ccp110	G	A	7: 118,729,725		probably null	Het
Fgfrl1	T	C	5: 108,705,302	C173R	probably damaging	Het
Gm5431	G	A	11: 48,894,756	T264M	possibly damaging	Het
Golga1	T	C	2: 39,020,099	E637G	probably damaging	Het
Hcn4	T	A	9: 58,859,293		probably null	Het
Krt86	G	A	15: 101,476,505	V260I	probably benign	Het
Ktn1	A	T	14: 47,690,033	Q548L	probably damaging	Het
Lingo4	A	T	3: 94,401,913	I53F	probably benign	Het
Lrrk1	A	C	7: 66,307,215	I336S	probably benign	Het
Magel2	G	T	7: 62,379,766	G806V	unknown	Het
Mrc2	T	A	11: 105,333,666	S501T	probably damaging	Het
Mrps18a	T	A	17: 46,125,649	L128*	probably null	Het
Mtor	G	T	4: 148,491,470	L1360F	probably damaging	Het
Mtpap	A	G	18: 4,379,674	E88G	probably damaging	Het
Myo5c	A	G	9: 75,289,154	K1294R	probably benign	Het
Olfr118	G	A	17: 37,672,285	M87I	possibly damaging	Het
Pik3c3	G	A	18: 30,311,293	V520M	probably damaging	Het
Pptc7	T	A	5: 122,320,855	V305E	probably damaging	Het
Ptgfrn	T	C	3: 101,056,250	D682G	probably damaging	Het
Rfx6	A	T	10: 51,723,061	Q538L	probably damaging	Het
Sbk1	G	A	7: 126,292,243	R283H	probably damaging	Het
Sfswap	T	C	5: 129,513,158	F240L	probably damaging	Het
Siglec1	T	A	2: 131,085,583	H101L	probably benign	Het
Smg1	A	G	7: 118,167,884		probably benign	Het
Spink5	A	G	18: 44,018,711	T986A	probably damaging	Het
Stat1	T	A	1: 52,148,942	S496T	probably benign	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tenm2	C	T	11: 36,163,714		probably null	Het
Tiam1	G	T	16: 89,865,365	R622S	probably damaging	Het
Vmn2r109	C	A	17: 20,540,927	D723Y	probably damaging	Het
Vmn2r70	G	T	7: 85,563,727	Q491K	probably benign	Het
Wdr66	T	C	5: 123,288,698	V383A	possibly damaging	Het
Wnk1	A	C	6: 119,949,358	S1297R	probably damaging	Het
Zan	C	T	5: 137,386,971	V5067I	unknown	Het
Zfp108	A	G	7: 24,260,586	S201G	probably benign	Het

Other mutations in Gpr158

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Gpr158	APN	2	21368683	missense	probably damaging	1.00
IGL00469:Gpr158	APN	2	21746795	splice site	probably benign
IGL00706:Gpr158	APN	2	21746773	missense	probably damaging	1.00
IGL00780:Gpr158	APN	2	21826818	nonsense	probably null
IGL00885:Gpr158	APN	2	21649021	missense	probably damaging	1.00
IGL01339:Gpr158	APN	2	21369031	missense	possibly damaging	0.73
IGL01368:Gpr158	APN	2	21827098	missense	probably damaging	1.00
IGL02141:Gpr158	APN	2	21783290	missense	probably damaging	0.99
IGL02455:Gpr158	APN	2	21368700	missense	probably benign	0.00
IGL02554:Gpr158	APN	2	21826596	missense	probably benign
IGL02681:Gpr158	APN	2	21815630	missense	probably damaging	1.00
IGL02752:Gpr158	APN	2	21826827	missense	possibly damaging	0.95
IGL02756:Gpr158	APN	2	21827079	missense	possibly damaging	0.47
IGL03181:Gpr158	APN	2	21783161	missense	probably benign	0.02
IGL03258:Gpr158	APN	2	21825274	missense	probably damaging	1.00
IGL03386:Gpr158	APN	2	21826246	missense	probably damaging	1.00
PIT4810001:Gpr158	UTSW	2	21826871	missense	probably benign	0.01
R0071:Gpr158	UTSW	2	21810668	missense	probably benign	0.08
R0081:Gpr158	UTSW	2	21826717	missense	probably damaging	1.00
R0528:Gpr158	UTSW	2	21825208	missense	probably damaging	1.00
R0560:Gpr158	UTSW	2	21825274	missense	probably damaging	1.00
R0603:Gpr158	UTSW	2	21815669	missense	possibly damaging	0.67
R1560:Gpr158	UTSW	2	21826314	missense	probably damaging	1.00
R1561:Gpr158	UTSW	2	21815694	splice site	probably null
R1609:Gpr158	UTSW	2	21783293	missense	possibly damaging	0.61
R1741:Gpr158	UTSW	2	21827548	missense	probably benign	0.00
R1827:Gpr158	UTSW	2	21827318	missense	probably benign
R1854:Gpr158	UTSW	2	21369124	missense	probably damaging	1.00
R1871:Gpr158	UTSW	2	21815615	missense	probably damaging	1.00
R2151:Gpr158	UTSW	2	21827514	missense	possibly damaging	0.82
R2273:Gpr158	UTSW	2	21826863	missense	probably benign
R2275:Gpr158	UTSW	2	21826863	missense	probably benign
R3004:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R3151:Gpr158	UTSW	2	21576960	missense	possibly damaging	0.68
R3943:Gpr158	UTSW	2	21368559	missense	possibly damaging	0.65
R4238:Gpr158	UTSW	2	21368551	missense	probably damaging	1.00
R4379:Gpr158	UTSW	2	21825214	missense	probably damaging	1.00
R4381:Gpr158	UTSW	2	21827592	missense	probably damaging	1.00
R4464:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4467:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4496:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4506:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4530:Gpr158	UTSW	2	21369000	missense	probably benign	0.03
R4646:Gpr158	UTSW	2	21827053	missense	probably benign
R4798:Gpr158	UTSW	2	21783182	missense	probably damaging	1.00
R4882:Gpr158	UTSW	2	21825248	missense	probably damaging	0.98
R4943:Gpr158	UTSW	2	21827157	missense	probably damaging	1.00
R5334:Gpr158	UTSW	2	21827505	missense	probably benign	0.01
R5560:Gpr158	UTSW	2	21826290	missense	possibly damaging	0.67
R5637:Gpr158	UTSW	2	21783272	missense	probably benign	0.00
R5701:Gpr158	UTSW	2	21746709	missense	probably damaging	1.00
R5744:Gpr158	UTSW	2	21368520	missense	probably damaging	1.00
R5911:Gpr158	UTSW	2	21369121	missense	possibly damaging	0.95
R5991:Gpr158	UTSW	2	21368508	missense	probably damaging	0.99
R6200:Gpr158	UTSW	2	21399416	missense	probably damaging	0.97
R6306:Gpr158	UTSW	2	21815611	missense	possibly damaging	0.84
R6324:Gpr158	UTSW	2	21810554	missense	probably damaging	1.00
R6384:Gpr158	UTSW	2	21826288	missense	probably damaging	1.00
R6698:Gpr158	UTSW	2	21827110	missense	probably damaging	1.00
R6997:Gpr158	UTSW	2	21648991	missense	possibly damaging	0.46
R7086:Gpr158	UTSW	2	21826575	missense	probably benign	0.01
R7175:Gpr158	UTSW	2	21368302	missense	probably benign	0.13
R7197:Gpr158	UTSW	2	21810601	missense	probably damaging	0.99
R7293:Gpr158	UTSW	2	21576939	missense	possibly damaging	0.47
R7427:Gpr158	UTSW	2	21827318	missense	probably benign
R7515:Gpr158	UTSW	2	21368281	missense	probably damaging	1.00
R7730:Gpr158	UTSW	2	21826347	missense	probably damaging	1.00
X0062:Gpr158	UTSW	2	21826369	missense	probably damaging	1.00
Z1176:Gpr158	UTSW	2	21810690	critical splice donor site	probably null
Z1177:Gpr158	UTSW	2	21827272	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- CCGGTATCACCCAGATAAAGG -3'
(R):5'- ACGACTTTGTGGGGCAGTTC -3'

Sequencing Primer
(F):5'- TCACCCAGATAAAGGACAATTTTG -3'
(R):5'- CCCAGCACACATATTGGTTGTGTAG -3'

Posted On

2016-10-26