Incidental Mutation 'R5600:Golga1'
ID 438971
Institutional Source Beutler Lab
Gene Symbol Golga1
Ensembl Gene ENSMUSG00000026754
Gene Name golgin A1
Synonyms Golgi97, golgin-97, 0710001G09Rik, awag, 2210418B03Rik
MMRRC Submission 043152-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R5600 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 38906167-38955553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38910111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 637 (E637G)
Ref Sequence ENSEMBL: ENSMUSP00000139001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000090993] [ENSMUST00000112850] [ENSMUST00000112862] [ENSMUST00000184996]
AlphaFold Q9CW79
Predicted Effect probably damaging
Transcript: ENSMUST00000039165
AA Change: E637G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: E637G

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090993
SMART Domains Protein: ENSMUSP00000088516
Gene: ENSMUSG00000026755

DomainStartEndE-ValueType
Pfam:P16-Arc 8 153 4.6e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112850
AA Change: E612G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: E612G

DomainStartEndE-ValueType
coiled coil region 53 144 N/A INTRINSIC
coiled coil region 165 530 N/A INTRINSIC
coiled coil region 574 622 N/A INTRINSIC
Grip 657 703 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112862
SMART Domains Protein: ENSMUSP00000108483
Gene: ENSMUSG00000026755

DomainStartEndE-ValueType
Pfam:P16-Arc 9 153 2.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135049
Predicted Effect probably damaging
Transcript: ENSMUST00000184996
AA Change: E637G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: E637G

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141467
Predicted Effect probably benign
Transcript: ENSMUST00000154210
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,519,288 (GRCm39) M264R probably damaging Het
Asprv1 G T 6: 86,606,044 (GRCm39) E297* probably null Het
Atp6v1c1 T C 15: 38,687,107 (GRCm39) V234A probably benign Het
Ccp110 G A 7: 118,328,948 (GRCm39) probably null Het
Cfap251 T C 5: 123,426,761 (GRCm39) V383A possibly damaging Het
Fgfrl1 T C 5: 108,853,168 (GRCm39) C173R probably damaging Het
Gm5431 G A 11: 48,785,583 (GRCm39) T264M possibly damaging Het
Gpr158 A G 2: 21,832,046 (GRCm39) T1049A probably benign Het
Hcn4 T A 9: 58,766,576 (GRCm39) probably null Het
Krt86 G A 15: 101,374,386 (GRCm39) V260I probably benign Het
Ktn1 A T 14: 47,927,490 (GRCm39) Q548L probably damaging Het
Lingo4 A T 3: 94,309,220 (GRCm39) I53F probably benign Het
Lrrk1 A C 7: 65,956,963 (GRCm39) I336S probably benign Het
Magel2 G T 7: 62,029,514 (GRCm39) G806V unknown Het
Mrc2 T A 11: 105,224,492 (GRCm39) S501T probably damaging Het
Mrps18a T A 17: 46,436,575 (GRCm39) L128* probably null Het
Mtor G T 4: 148,575,927 (GRCm39) L1360F probably damaging Het
Mtpap A G 18: 4,379,674 (GRCm39) E88G probably damaging Het
Myo5c A G 9: 75,196,436 (GRCm39) K1294R probably benign Het
Or10al2 G A 17: 37,983,176 (GRCm39) M87I possibly damaging Het
Pik3c3 G A 18: 30,444,346 (GRCm39) V520M probably damaging Het
Pptc7 T A 5: 122,458,918 (GRCm39) V305E probably damaging Het
Ptgfrn T C 3: 100,963,566 (GRCm39) D682G probably damaging Het
Rfx6 A T 10: 51,599,157 (GRCm39) Q538L probably damaging Het
Sbk1 G A 7: 125,891,415 (GRCm39) R283H probably damaging Het
Sfswap T C 5: 129,590,222 (GRCm39) F240L probably damaging Het
Siglec1 T A 2: 130,927,503 (GRCm39) H101L probably benign Het
Smg1 A G 7: 117,767,107 (GRCm39) probably benign Het
Spink5 A G 18: 44,151,778 (GRCm39) T986A probably damaging Het
Stat1 T A 1: 52,188,101 (GRCm39) S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Tenm2 C T 11: 36,054,541 (GRCm39) probably null Het
Tiam1 G T 16: 89,662,253 (GRCm39) R622S probably damaging Het
Vmn2r109 C A 17: 20,761,189 (GRCm39) D723Y probably damaging Het
Vmn2r70 G T 7: 85,212,935 (GRCm39) Q491K probably benign Het
Wnk1 A C 6: 119,926,319 (GRCm39) S1297R probably damaging Het
Zan C T 5: 137,385,233 (GRCm39) V5067I unknown Het
Zfp108 A G 7: 23,960,011 (GRCm39) S201G probably benign Het
Other mutations in Golga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Golga1 APN 2 38,942,985 (GRCm39) nonsense probably null
IGL00949:Golga1 APN 2 38,931,267 (GRCm39) missense probably damaging 0.98
IGL01133:Golga1 APN 2 38,913,484 (GRCm39) missense probably benign
IGL01592:Golga1 APN 2 38,953,294 (GRCm39) missense probably damaging 1.00
IGL01613:Golga1 APN 2 38,910,138 (GRCm39) missense probably benign 0.14
IGL01819:Golga1 APN 2 38,924,161 (GRCm39) missense probably benign 0.00
IGL01871:Golga1 APN 2 38,940,210 (GRCm39) splice site probably benign
IGL02744:Golga1 APN 2 38,908,486 (GRCm39) missense probably damaging 1.00
IGL02819:Golga1 APN 2 38,929,090 (GRCm39) missense probably null 0.97
IGL02874:Golga1 APN 2 38,929,104 (GRCm39) missense probably damaging 1.00
R0167:Golga1 UTSW 2 38,937,660 (GRCm39) missense probably benign 0.00
R0245:Golga1 UTSW 2 38,925,271 (GRCm39) missense probably benign 0.00
R0389:Golga1 UTSW 2 38,908,453 (GRCm39) missense probably damaging 1.00
R0443:Golga1 UTSW 2 38,908,453 (GRCm39) missense probably damaging 1.00
R0906:Golga1 UTSW 2 38,937,655 (GRCm39) missense probably damaging 0.99
R1508:Golga1 UTSW 2 38,913,261 (GRCm39) missense probably benign
R1901:Golga1 UTSW 2 38,937,792 (GRCm39) splice site probably null
R1964:Golga1 UTSW 2 38,937,099 (GRCm39) missense probably benign 0.00
R2228:Golga1 UTSW 2 38,913,183 (GRCm39) missense probably benign 0.02
R3734:Golga1 UTSW 2 38,940,182 (GRCm39) missense possibly damaging 0.88
R4407:Golga1 UTSW 2 38,909,653 (GRCm39) splice site probably null
R4504:Golga1 UTSW 2 38,913,466 (GRCm39) missense probably benign 0.00
R4973:Golga1 UTSW 2 38,929,118 (GRCm39) missense probably damaging 0.99
R5049:Golga1 UTSW 2 38,937,747 (GRCm39) missense probably damaging 1.00
R6008:Golga1 UTSW 2 38,937,099 (GRCm39) missense probably benign 0.00
R6374:Golga1 UTSW 2 38,924,080 (GRCm39) missense probably benign
R6388:Golga1 UTSW 2 38,913,183 (GRCm39) missense probably benign 0.02
R6601:Golga1 UTSW 2 38,910,118 (GRCm39) missense probably damaging 1.00
R7067:Golga1 UTSW 2 38,937,731 (GRCm39) missense probably benign 0.00
R7816:Golga1 UTSW 2 38,942,110 (GRCm39) missense probably damaging 1.00
R9277:Golga1 UTSW 2 38,914,255 (GRCm39) missense probably benign 0.19
R9581:Golga1 UTSW 2 38,909,573 (GRCm39) missense probably damaging 1.00
X0025:Golga1 UTSW 2 38,942,074 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCCCAAGGTCACAAG -3'
(R):5'- AATAATACTGTGGCCCCTCAGG -3'

Sequencing Primer
(F):5'- TTCTCAAGATCTAAGGCCATACTC -3'
(R):5'- TCAGGGGCCTCAGAAAGC -3'
Posted On 2016-10-26