Incidental Mutation 'R5600:Ptgfrn'
ID 438974
Institutional Source Beutler Lab
Gene Symbol Ptgfrn
Ensembl Gene ENSMUSG00000027864
Gene Name prostaglandin F2 receptor negative regulator
Synonyms CD9P-1, 4833445A08Rik
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5600 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 101040232-101110278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101056250 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 682 (D682G)
Ref Sequence ENSEMBL: ENSMUSP00000099755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102694]
AlphaFold Q9WV91
Predicted Effect probably damaging
Transcript: ENSMUST00000102694
AA Change: D682G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: D682G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 121 3.01e-7 SMART
IG 154 264 1.54e-4 SMART
IG 284 390 1.11e-5 SMART
IG 414 532 1.72e-2 SMART
IG 556 676 9.71e-2 SMART
IG 696 822 5.21e-2 SMART
transmembrane domain 831 853 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198037
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Ptgfrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ptgfrn APN 3 101072845 missense probably benign 0.01
IGL01710:Ptgfrn APN 3 101073088 missense probably damaging 0.98
IGL02557:Ptgfrn APN 3 101060636 critical splice donor site probably null
IGL02740:Ptgfrn APN 3 101072937 missense possibly damaging 0.84
IGL02817:Ptgfrn APN 3 101060752 missense probably benign
IGL02948:Ptgfrn APN 3 101072819 missense probably benign 0.21
R1540:Ptgfrn UTSW 3 101060654 missense probably benign 0.41
R1563:Ptgfrn UTSW 3 101060651 missense possibly damaging 0.67
R1730:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1766:Ptgfrn UTSW 3 101050122 missense probably benign 0.00
R1783:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1918:Ptgfrn UTSW 3 101056307 missense probably benign
R2113:Ptgfrn UTSW 3 101077309 missense probably benign 0.00
R2290:Ptgfrn UTSW 3 101077361 missense possibly damaging 0.77
R3522:Ptgfrn UTSW 3 101043402 missense probably damaging 1.00
R5223:Ptgfrn UTSW 3 101045593 missense probably benign 0.13
R5642:Ptgfrn UTSW 3 101043362 missense probably damaging 1.00
R5927:Ptgfrn UTSW 3 101060652 missense possibly damaging 0.92
R5984:Ptgfrn UTSW 3 101050143 missense probably damaging 0.99
R6124:Ptgfrn UTSW 3 101073089 missense probably damaging 0.98
R6331:Ptgfrn UTSW 3 101045620 missense possibly damaging 0.64
R6363:Ptgfrn UTSW 3 101045578 missense possibly damaging 0.93
R6473:Ptgfrn UTSW 3 101045639 missense probably damaging 1.00
R6856:Ptgfrn UTSW 3 101045446 missense probably damaging 1.00
R7151:Ptgfrn UTSW 3 101080195 nonsense probably null
R7313:Ptgfrn UTSW 3 101073047 missense possibly damaging 0.84
R7361:Ptgfrn UTSW 3 101077444 missense probably benign 0.03
R7806:Ptgfrn UTSW 3 101077132 missense possibly damaging 0.50
R7823:Ptgfrn UTSW 3 101043409 missense probably damaging 1.00
R7841:Ptgfrn UTSW 3 101060810 missense probably damaging 0.98
R8093:Ptgfrn UTSW 3 101056437 missense probably benign 0.19
R8093:Ptgfrn UTSW 3 101072941 missense probably benign 0.09
R8490:Ptgfrn UTSW 3 101056370 missense probably damaging 0.99
R8856:Ptgfrn UTSW 3 101056611 missense possibly damaging 0.86
Z1088:Ptgfrn UTSW 3 101056437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCACATAAGCCACACTC -3'
(R):5'- AGTACATTATCTCCCTGGACCAG -3'

Sequencing Primer
(F):5'- TGTGCACATAAGCCACACTCATATAC -3'
(R):5'- AGGACTCCGTGGTGAAGCTG -3'
Posted On 2016-10-26