Incidental Mutation 'R5600:Asprv1'
ID438983
Institutional Source Beutler Lab
Gene Symbol Asprv1
Ensembl Gene ENSMUSG00000033508
Gene Nameaspartic peptidase, retroviral-like 1
SynonymsTaps, SASPase, TPA-induced aspartic proteinase-like, SASP, 2300003P22Rik
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86628164-86629710 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 86629062 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 297 (E297*)
Ref Sequence ENSEMBL: ENSMUSP00000046121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043400]
Predicted Effect probably null
Transcript: ENSMUST00000043400
AA Change: E297*
SMART Domains Protein: ENSMUSP00000046121
Gene: ENSMUSG00000033508
AA Change: E297*

DomainStartEndE-ValueType
Pfam:Asp_protease 177 295 1.3e-8 PFAM
Pfam:Asp_protease_2 196 286 1.6e-10 PFAM
low complexity region 314 338 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele develop fine skin wrinkles at the side of their body without any apparent epidermal differentiation defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Asprv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Asprv1 APN 6 86628918 missense probably damaging 0.99
quince UTSW 6 86628840 missense probably damaging 1.00
R0254:Asprv1 UTSW 6 86629095 missense probably damaging 1.00
R0311:Asprv1 UTSW 6 86628840 missense probably damaging 1.00
R1538:Asprv1 UTSW 6 86628636 nonsense probably null
R1661:Asprv1 UTSW 6 86628736 missense probably damaging 0.97
R1792:Asprv1 UTSW 6 86628372 missense possibly damaging 0.59
R2964:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R2965:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R2966:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R4748:Asprv1 UTSW 6 86628423 missense probably damaging 0.98
R5655:Asprv1 UTSW 6 86628482 missense probably benign 0.05
R5704:Asprv1 UTSW 6 86628550 missense probably damaging 1.00
R5715:Asprv1 UTSW 6 86628614 missense probably benign
R6259:Asprv1 UTSW 6 86628379 missense probably benign 0.05
R6899:Asprv1 UTSW 6 86628760 missense probably damaging 1.00
R7451:Asprv1 UTSW 6 86628948 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAATGTGGTCAAAGTGGCC -3'
(R):5'- CCGGTGTAAAGACTGGCTAG -3'

Sequencing Primer
(F):5'- TCAAAGTGGCCAATGGGG -3'
(R):5'- TAGGCCGGATGATACCCC -3'
Posted On2016-10-26