Incidental Mutation 'R5600:Zfp108'
ID438985
Institutional Source Beutler Lab
Gene Symbol Zfp108
Ensembl Gene ENSMUSG00000030486
Gene Namezinc finger protein 108
Synonyms
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24254794-24262445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24260586 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 201 (S201G)
Ref Sequence ENSEMBL: ENSMUSP00000145928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072713] [ENSMUST00000205982] [ENSMUST00000206777]
Predicted Effect probably benign
Transcript: ENSMUST00000072713
AA Change: S201G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072496
Gene: ENSMUSG00000030486
AA Change: S201G

DomainStartEndE-ValueType
KRAB 8 63 7.94e-18 SMART
low complexity region 140 153 N/A INTRINSIC
ZnF_C2H2 281 303 1.33e-1 SMART
ZnF_C2H2 309 331 1.69e-3 SMART
ZnF_C2H2 337 359 1.3e-4 SMART
ZnF_C2H2 365 387 2.71e-2 SMART
ZnF_C2H2 393 415 5.14e-3 SMART
ZnF_C2H2 421 443 1.87e-5 SMART
ZnF_C2H2 449 471 3.44e-4 SMART
ZnF_C2H2 477 497 1.08e1 SMART
ZnF_C2H2 503 525 3.89e-3 SMART
ZnF_C2H2 531 553 2.09e-3 SMART
ZnF_C2H2 559 581 4.61e-5 SMART
ZnF_C2H2 587 609 7.9e-4 SMART
ZnF_C2H2 615 637 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205982
AA Change: S201G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000206777
AA Change: S201G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Other mutations in Zfp108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Zfp108 APN 7 24261486 missense possibly damaging 0.82
IGL01392:Zfp108 APN 7 24258447 splice site probably benign
R0123:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0126:Zfp108 UTSW 7 24260724 missense probably benign 0.01
R0134:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0243:Zfp108 UTSW 7 24261783 missense possibly damaging 0.81
R1227:Zfp108 UTSW 7 24260460 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1731:Zfp108 UTSW 7 24258539 missense possibly damaging 0.75
R1739:Zfp108 UTSW 7 24261310 missense probably damaging 1.00
R1751:Zfp108 UTSW 7 24261896 missense probably damaging 1.00
R3713:Zfp108 UTSW 7 24261845 nonsense probably null
R3839:Zfp108 UTSW 7 24260556 missense probably benign 0.01
R3919:Zfp108 UTSW 7 24260832 missense probably damaging 0.99
R3922:Zfp108 UTSW 7 24261348 missense probably damaging 1.00
R4707:Zfp108 UTSW 7 24260412 missense probably benign 0.08
R4912:Zfp108 UTSW 7 24261314 missense probably damaging 1.00
R4965:Zfp108 UTSW 7 24260148 missense probably benign
R4989:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5014:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5163:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5183:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5184:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5185:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5453:Zfp108 UTSW 7 24261264 missense probably damaging 1.00
R6494:Zfp108 UTSW 7 24261357 missense probably damaging 1.00
R6601:Zfp108 UTSW 7 24261394 missense probably damaging 0.98
R6735:Zfp108 UTSW 7 24261772 missense probably damaging 1.00
R7646:Zfp108 UTSW 7 24261415 missense probably damaging 1.00
R7732:Zfp108 UTSW 7 24261527 missense probably benign 0.00
R7873:Zfp108 UTSW 7 24261333 missense probably benign 0.19
R7956:Zfp108 UTSW 7 24261333 missense probably benign 0.19
RF019:Zfp108 UTSW 7 24261607 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCACCAGCAACCATTCTG -3'
(R):5'- AGTACTATGCACAGGGGACTTC -3'

Sequencing Primer
(F):5'- CTGAAAGTCAAGAATTTCTGTCTGGG -3'
(R):5'- CACAGGGGACTTCTTTCCTAAGAG -3'
Posted On2016-10-26