Incidental Mutation 'R5600:Ccp110'
ID438989
Institutional Source Beutler Lab
Gene Symbol Ccp110
Ensembl Gene ENSMUSG00000033904
Gene Namecentriolar coiled coil protein 110
Synonyms6330503K22Rik, CP110
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location118712552-118737024 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 118729725 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000038650] [ENSMUST00000038650] [ENSMUST00000106557] [ENSMUST00000106557]
Predicted Effect probably null
Transcript: ENSMUST00000038650
SMART Domains Protein: ENSMUSP00000038881
Gene: ENSMUSG00000033904

DomainStartEndE-ValueType
Pfam:CALM_bind 29 135 7.4e-21 PFAM
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000038650
SMART Domains Protein: ENSMUSP00000038881
Gene: ENSMUSG00000033904

DomainStartEndE-ValueType
Pfam:CALM_bind 29 135 7.4e-21 PFAM
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106557
SMART Domains Protein: ENSMUSP00000102167
Gene: ENSMUSG00000033904

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106557
SMART Domains Protein: ENSMUSP00000102167
Gene: ENSMUSG00000033904

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123178
Predicted Effect probably null
Transcript: ENSMUST00000123178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149056
Predicted Effect probably null
Transcript: ENSMUST00000208766
Predicted Effect probably null
Transcript: ENSMUST00000208766
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pleiotropic phenotypes due to impaired sonic hedgehog (Shh) signaling and failure of primary cilia formation in multiple tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Ccp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ccp110 APN 7 118722424 missense possibly damaging 0.79
IGL00481:Ccp110 APN 7 118729997 missense possibly damaging 0.70
IGL00725:Ccp110 APN 7 118730723 missense probably damaging 0.99
IGL00899:Ccp110 APN 7 118722684 missense probably benign
IGL01837:Ccp110 APN 7 118725461 critical splice donor site probably null
PIT4469001:Ccp110 UTSW 7 118722377 missense probably benign 0.06
R1217:Ccp110 UTSW 7 118729944 splice site probably benign
R1640:Ccp110 UTSW 7 118715528 splice site probably null
R1700:Ccp110 UTSW 7 118735313 missense probably damaging 0.99
R1768:Ccp110 UTSW 7 118726024 unclassified probably null
R4737:Ccp110 UTSW 7 118724548 missense possibly damaging 0.96
R4859:Ccp110 UTSW 7 118725430 missense possibly damaging 0.93
R4933:Ccp110 UTSW 7 118725319 missense probably damaging 0.96
R4970:Ccp110 UTSW 7 118722391 missense possibly damaging 0.85
R4999:Ccp110 UTSW 7 118730012 nonsense probably null
R5212:Ccp110 UTSW 7 118729696 missense probably damaging 0.99
R6953:Ccp110 UTSW 7 118722421 missense possibly damaging 0.85
R6998:Ccp110 UTSW 7 118732897 missense possibly damaging 0.91
R7076:Ccp110 UTSW 7 118732405 missense probably damaging 1.00
R7092:Ccp110 UTSW 7 118735271 missense probably benign 0.26
R7336:Ccp110 UTSW 7 118722210 missense probably damaging 0.99
R7343:Ccp110 UTSW 7 118724575 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTATGGCTGCTTGATATGTCATC -3'
(R):5'- TGTGAAAGACGAAACCAGTGTC -3'

Sequencing Primer
(F):5'- GGCTGCTTGATATGTCATCAGTAATC -3'
(R):5'- GTGAAAGACGAAACCAGTGTCTACAC -3'
Posted On2016-10-26