Incidental Mutation 'R5600:Ktn1'
ID438997
Institutional Source Beutler Lab
Gene Symbol Ktn1
Ensembl Gene ENSMUSG00000021843
Gene Namekinectin 1
Synonyms
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47648448-47739894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47690033 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 548 (Q548L)
Ref Sequence ENSEMBL: ENSMUSP00000140845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022391] [ENSMUST00000185343] [ENSMUST00000185940] [ENSMUST00000186627] [ENSMUST00000186761] [ENSMUST00000187039] [ENSMUST00000187262] [ENSMUST00000187839] [ENSMUST00000188330] [ENSMUST00000188553] [ENSMUST00000189101] [ENSMUST00000189533] [ENSMUST00000189986] [ENSMUST00000190182] [ENSMUST00000190252] [ENSMUST00000190535] [ENSMUST00000190999] [ENSMUST00000191018] [ENSMUST00000191446] [ENSMUST00000191511]
Predicted Effect probably damaging
Transcript: ENSMUST00000022391
AA Change: Q548L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022391
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185343
AA Change: Q548L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140186
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185940
AA Change: Q548L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139625
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186627
AA Change: Q548L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140873
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186761
AA Change: Q548L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139521
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187039
AA Change: Q548L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140202
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187262
AA Change: Q548L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140206
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187839
AA Change: Q548L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140324
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188330
AA Change: Q548L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140845
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188553
AA Change: Q548L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140865
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189101
AA Change: Q548L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140178
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189533
AA Change: Q548L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140142
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
coiled coil region 1222 1246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189986
SMART Domains Protein: ENSMUSP00000139970
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
Pfam:Rib_recp_KP_reg 29 172 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190182
AA Change: Q548L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140301
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1238 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190252
AA Change: Q548L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140011
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
coiled coil region 1245 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190535
AA Change: Q548L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139952
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1244 N/A INTRINSIC
coiled coil region 1279 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190999
AA Change: Q548L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139673
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191018
AA Change: Q548L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139585
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1220 N/A INTRINSIC
coiled coil region 1255 1279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191446
AA Change: Q548L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140748
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191511
AA Change: Q548L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139946
Gene: ENSMUSG00000021843
AA Change: Q548L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
coiled coil region 1227 1251 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation or a floxed allele exhibit no discernable phenotype; mice are viable and fertile up to one year of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Ktn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ktn1 APN 14 47708878 missense probably benign 0.30
IGL01109:Ktn1 APN 14 47714721 missense probably damaging 1.00
IGL02300:Ktn1 APN 14 47690060 missense probably damaging 1.00
IGL02339:Ktn1 APN 14 47683378 splice site probably benign
IGL02525:Ktn1 APN 14 47724743 critical splice donor site probably null
IGL02565:Ktn1 APN 14 47672934 splice site probably benign
IGL02678:Ktn1 APN 14 47734153 critical splice acceptor site probably null
IGL03181:Ktn1 APN 14 47733284 missense probably benign 0.19
IGL03393:Ktn1 APN 14 47690934 missense probably damaging 1.00
PIT4520001:Ktn1 UTSW 14 47686317 missense probably damaging 0.96
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0270:Ktn1 UTSW 14 47714662 missense probably benign 0.00
R0370:Ktn1 UTSW 14 47664075 missense probably benign 0.00
R0371:Ktn1 UTSW 14 47724003 nonsense probably null
R0530:Ktn1 UTSW 14 47733243 missense probably benign 0.14
R0531:Ktn1 UTSW 14 47663941 missense probably damaging 0.98
R0611:Ktn1 UTSW 14 47694616 missense probably benign
R0836:Ktn1 UTSW 14 47701062 splice site probably null
R1076:Ktn1 UTSW 14 47694638 missense probably damaging 0.99
R1522:Ktn1 UTSW 14 47667416 missense probably damaging 1.00
R1554:Ktn1 UTSW 14 47695507 missense probably damaging 1.00
R1992:Ktn1 UTSW 14 47695521 missense probably damaging 1.00
R2040:Ktn1 UTSW 14 47700612 splice site probably benign
R2080:Ktn1 UTSW 14 47725960 missense probably damaging 1.00
R2110:Ktn1 UTSW 14 47693888 missense possibly damaging 0.47
R2144:Ktn1 UTSW 14 47714652 missense probably damaging 1.00
R3730:Ktn1 UTSW 14 47701149 missense probably damaging 1.00
R3780:Ktn1 UTSW 14 47706403 splice site probably benign
R3782:Ktn1 UTSW 14 47706403 splice site probably benign
R4414:Ktn1 UTSW 14 47724930 nonsense probably null
R4610:Ktn1 UTSW 14 47726179 intron probably benign
R4784:Ktn1 UTSW 14 47693496 critical splice donor site probably null
R4838:Ktn1 UTSW 14 47725956 nonsense probably null
R4909:Ktn1 UTSW 14 47706460 missense probably damaging 0.99
R4976:Ktn1 UTSW 14 47670299 critical splice donor site probably null
R5110:Ktn1 UTSW 14 47704287 splice site probably benign
R5257:Ktn1 UTSW 14 47667363 missense probably benign 0.05
R5469:Ktn1 UTSW 14 47690920 missense probably damaging 1.00
R5607:Ktn1 UTSW 14 47734097 intron probably benign
R5608:Ktn1 UTSW 14 47734097 intron probably benign
R5920:Ktn1 UTSW 14 47724024 nonsense probably null
R6045:Ktn1 UTSW 14 47676796 missense probably damaging 1.00
R6139:Ktn1 UTSW 14 47726215 splice site probably null
R6282:Ktn1 UTSW 14 47663971 missense probably damaging 1.00
R6654:Ktn1 UTSW 14 47690000 missense probably damaging 1.00
R6957:Ktn1 UTSW 14 47667353 nonsense probably null
R6959:Ktn1 UTSW 14 47720256 missense probably damaging 1.00
R7170:Ktn1 UTSW 14 47706410 missense probably damaging 1.00
R7206:Ktn1 UTSW 14 47695528 missense probably damaging 0.97
R7442:Ktn1 UTSW 14 47714640 missense probably benign 0.01
R7462:Ktn1 UTSW 14 47694632 missense probably null 1.00
R7513:Ktn1 UTSW 14 47664084 missense possibly damaging 0.77
R7743:Ktn1 UTSW 14 47670293 missense probably damaging 1.00
R8010:Ktn1 UTSW 14 47705773 missense possibly damaging 0.60
R8062:Ktn1 UTSW 14 47724972 critical splice donor site probably null
R8244:Ktn1 UTSW 14 47674823 missense probably null 1.00
Z1177:Ktn1 UTSW 14 47692438 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGCGCAAGTGTTCCAGAG -3'
(R):5'- CACTGAACCGGAAGTTTATTGAAC -3'

Sequencing Primer
(F):5'- TGTTCCAGAGAGGGCAACGC -3'
(R):5'- ATTAAATCATTTCCACTCAACCTCC -3'
Posted On2016-10-26