Incidental Mutation 'R5600:Krt86'
ID439000
Institutional Source Beutler Lab
Gene Symbol Krt86
Ensembl Gene ENSMUSG00000067614
Gene Namekeratin 86
SynonymsKrt2-10, Khb4, Krt2-11, MHb4
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101473478-101479986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101476505 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 260 (V260I)
Ref Sequence ENSEMBL: ENSMUSP00000085365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088049]
Predicted Effect probably benign
Transcript: ENSMUST00000088049
AA Change: V260I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000085365
Gene: ENSMUSG00000067614
AA Change: V260I

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 102 4.6e-15 PFAM
Filament 105 416 6.92e-148 SMART
low complexity region 420 438 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230173
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II keratin protein, which heterodimerizes with type I keratins to form hair and nails. This gene is present in a cluster of related genes and pseudogenes on chromosome 12. Mutations in this gene have been observed in patients with the hair disease monilethrix. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Krt86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt86 APN 15 101476515 missense possibly damaging 0.55
IGL00597:Krt86 APN 15 101476226 missense probably benign 0.01
IGL00776:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00800:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00801:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00857:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00902:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00903:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00939:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00954:Krt86 APN 15 101473860 missense probably benign 0.00
IGL01107:Krt86 APN 15 101475425 missense probably damaging 1.00
IGL01638:Krt86 APN 15 101475472 splice site probably benign
IGL02711:Krt86 APN 15 101473662 missense probably damaging 1.00
R0046:Krt86 UTSW 15 101477402 missense probably benign 0.00
R0193:Krt86 UTSW 15 101479363 splice site probably benign
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0607:Krt86 UTSW 15 101479531 missense unknown
R2139:Krt86 UTSW 15 101473758 missense probably benign 0.11
R4464:Krt86 UTSW 15 101473914 missense probably damaging 0.99
R4985:Krt86 UTSW 15 101477265 missense probably damaging 0.99
R5195:Krt86 UTSW 15 101476933 missense probably benign 0.10
R5587:Krt86 UTSW 15 101473593 missense probably benign 0.01
R5729:Krt86 UTSW 15 101476548 missense probably benign 0.18
R5876:Krt86 UTSW 15 101476610 missense probably damaging 0.98
R6169:Krt86 UTSW 15 101476289 missense probably damaging 1.00
R6776:Krt86 UTSW 15 101476936 missense probably benign 0.29
R6990:Krt86 UTSW 15 101473833 missense probably benign 0.03
R7111:Krt86 UTSW 15 101476617 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCAGCCAGGTAGAAGTACATCG -3'
(R):5'- TGGTGTGCAAGAAGCCCTTTC -3'

Sequencing Primer
(F):5'- AAGTACATCGAGTAGTCTGTAGAC -3'
(R):5'- GTGTGCAAGAAGCCCTTTCCAATAG -3'
Posted On2016-10-26