Incidental Mutation 'R5600:Vmn2r109'
ID 439002
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission 043152-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R5600 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 20760779-20785018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20761189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 723 (D723Y)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably damaging
Transcript: ENSMUST00000167093
AA Change: D723Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: D723Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,519,288 (GRCm39) M264R probably damaging Het
Asprv1 G T 6: 86,606,044 (GRCm39) E297* probably null Het
Atp6v1c1 T C 15: 38,687,107 (GRCm39) V234A probably benign Het
Ccp110 G A 7: 118,328,948 (GRCm39) probably null Het
Cfap251 T C 5: 123,426,761 (GRCm39) V383A possibly damaging Het
Fgfrl1 T C 5: 108,853,168 (GRCm39) C173R probably damaging Het
Gm5431 G A 11: 48,785,583 (GRCm39) T264M possibly damaging Het
Golga1 T C 2: 38,910,111 (GRCm39) E637G probably damaging Het
Gpr158 A G 2: 21,832,046 (GRCm39) T1049A probably benign Het
Hcn4 T A 9: 58,766,576 (GRCm39) probably null Het
Krt86 G A 15: 101,374,386 (GRCm39) V260I probably benign Het
Ktn1 A T 14: 47,927,490 (GRCm39) Q548L probably damaging Het
Lingo4 A T 3: 94,309,220 (GRCm39) I53F probably benign Het
Lrrk1 A C 7: 65,956,963 (GRCm39) I336S probably benign Het
Magel2 G T 7: 62,029,514 (GRCm39) G806V unknown Het
Mrc2 T A 11: 105,224,492 (GRCm39) S501T probably damaging Het
Mrps18a T A 17: 46,436,575 (GRCm39) L128* probably null Het
Mtor G T 4: 148,575,927 (GRCm39) L1360F probably damaging Het
Mtpap A G 18: 4,379,674 (GRCm39) E88G probably damaging Het
Myo5c A G 9: 75,196,436 (GRCm39) K1294R probably benign Het
Or10al2 G A 17: 37,983,176 (GRCm39) M87I possibly damaging Het
Pik3c3 G A 18: 30,444,346 (GRCm39) V520M probably damaging Het
Pptc7 T A 5: 122,458,918 (GRCm39) V305E probably damaging Het
Ptgfrn T C 3: 100,963,566 (GRCm39) D682G probably damaging Het
Rfx6 A T 10: 51,599,157 (GRCm39) Q538L probably damaging Het
Sbk1 G A 7: 125,891,415 (GRCm39) R283H probably damaging Het
Sfswap T C 5: 129,590,222 (GRCm39) F240L probably damaging Het
Siglec1 T A 2: 130,927,503 (GRCm39) H101L probably benign Het
Smg1 A G 7: 117,767,107 (GRCm39) probably benign Het
Spink5 A G 18: 44,151,778 (GRCm39) T986A probably damaging Het
Stat1 T A 1: 52,188,101 (GRCm39) S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Tenm2 C T 11: 36,054,541 (GRCm39) probably null Het
Tiam1 G T 16: 89,662,253 (GRCm39) R622S probably damaging Het
Vmn2r70 G T 7: 85,212,935 (GRCm39) Q491K probably benign Het
Wnk1 A C 6: 119,926,319 (GRCm39) S1297R probably damaging Het
Zan C T 5: 137,385,233 (GRCm39) V5067I unknown Het
Zfp108 A G 7: 23,960,011 (GRCm39) S201G probably benign Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20,770,419 (GRCm39) missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20,761,383 (GRCm39) missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20,761,671 (GRCm39) missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20,774,654 (GRCm39) missense probably benign
IGL01864:Vmn2r109 APN 17 20,761,396 (GRCm39) missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20,761,342 (GRCm39) missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20,774,603 (GRCm39) missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20,774,422 (GRCm39) missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20,761,150 (GRCm39) missense probably benign
IGL02490:Vmn2r109 APN 17 20,761,246 (GRCm39) missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20,760,963 (GRCm39) missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20,774,518 (GRCm39) missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20,774,062 (GRCm39) missense probably benign
IGL02745:Vmn2r109 APN 17 20,761,512 (GRCm39) missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20,774,839 (GRCm39) critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20,773,148 (GRCm39) missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20,760,937 (GRCm39) missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20,761,670 (GRCm39) nonsense probably null
R0882:Vmn2r109 UTSW 17 20,774,842 (GRCm39) splice site probably benign
R1241:Vmn2r109 UTSW 17 20,775,503 (GRCm39) missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20,761,002 (GRCm39) missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20,774,072 (GRCm39) nonsense probably null
R1957:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20,774,185 (GRCm39) missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20,761,448 (GRCm39) nonsense probably null
R2073:Vmn2r109 UTSW 17 20,784,974 (GRCm39) missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20,774,798 (GRCm39) missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20,761,248 (GRCm39) missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20,774,704 (GRCm39) missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20,774,074 (GRCm39) missense probably benign
R4428:Vmn2r109 UTSW 17 20,773,286 (GRCm39) missense probably benign
R4584:Vmn2r109 UTSW 17 20,774,820 (GRCm39) nonsense probably null
R4652:Vmn2r109 UTSW 17 20,761,656 (GRCm39) missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20,761,605 (GRCm39) missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20,774,153 (GRCm39) missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20,761,494 (GRCm39) missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20,770,348 (GRCm39) missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20,775,451 (GRCm39) missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20,774,603 (GRCm39) missense possibly damaging 0.90
R5602:Vmn2r109 UTSW 17 20,760,933 (GRCm39) missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20,760,781 (GRCm39) makesense probably null
R5702:Vmn2r109 UTSW 17 20,774,407 (GRCm39) missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20,774,567 (GRCm39) missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20,773,121 (GRCm39) missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20,761,318 (GRCm39) missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20,760,981 (GRCm39) missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20,761,440 (GRCm39) missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20,784,796 (GRCm39) critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20,774,785 (GRCm39) missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20,760,932 (GRCm39) missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20,760,973 (GRCm39) missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20,785,006 (GRCm39) missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20,761,225 (GRCm39) missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20,760,945 (GRCm39) missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20,761,700 (GRCm39) missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20,761,043 (GRCm39) missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20,761,536 (GRCm39) missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20,774,665 (GRCm39) missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20,760,942 (GRCm39) missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20,773,117 (GRCm39) missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20,761,436 (GRCm39) missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20,760,782 (GRCm39) missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20,774,729 (GRCm39) missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20,774,531 (GRCm39) missense possibly damaging 0.96
R9687:Vmn2r109 UTSW 17 20,775,332 (GRCm39) missense
Z1176:Vmn2r109 UTSW 17 20,773,256 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACCAGCATGCTGAATGAC -3'
(R):5'- CCTTCAGCAGACCATATTTGGAG -3'

Sequencing Primer
(F):5'- TGACAGAAATTTGGATTCATTGAATG -3'
(R):5'- GCAGACCATATTTGGAGTTTCATTC -3'
Posted On 2016-10-26