Incidental Mutation 'R5600:Olfr118'
ID439003
Institutional Source Beutler Lab
Gene Symbol Olfr118
Ensembl Gene ENSMUSG00000080990
Gene Nameolfactory receptor 118
SynonymsMOR263-13, GA_x6K02T2PSCP-2131124-2132089
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37666988-37673476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37672285 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 87 (M87I)
Ref Sequence ENSEMBL: ENSMUSP00000151212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]
Predicted Effect possibly damaging
Transcript: ENSMUST00000122036
AA Change: M87I

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: M87I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 32 173 2e-6 PFAM
Pfam:7tm_4 37 314 2.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 41 311 5.8e-6 PFAM
Pfam:7tm_1 47 296 1.4e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215811
AA Change: M87I

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216551
AA Change: M87I

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Olfr118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Olfr118 APN 17 37672887 missense probably damaging 1.00
IGL02456:Olfr118 APN 17 37672449 missense possibly damaging 0.90
IGL02750:Olfr118 APN 17 37672609 nonsense probably null
IGL03083:Olfr118 APN 17 37672660 nonsense probably null
IGL03339:Olfr118 APN 17 37672557 missense possibly damaging 0.87
R0032:Olfr118 UTSW 17 37672487 missense probably damaging 1.00
R1457:Olfr118 UTSW 17 37672925 nonsense probably null
R1542:Olfr118 UTSW 17 37672251 missense probably damaging 1.00
R1771:Olfr118 UTSW 17 37672663 missense probably damaging 1.00
R1893:Olfr118 UTSW 17 37672856 nonsense probably null
R2395:Olfr118 UTSW 17 37672696 nonsense probably null
R3619:Olfr118 UTSW 17 37672640 missense probably benign 0.05
R3917:Olfr118 UTSW 17 37672793 missense probably damaging 1.00
R3937:Olfr118 UTSW 17 37672967 missense probably benign 0.01
R6415:Olfr118 UTSW 17 37672557 missense possibly damaging 0.87
R6462:Olfr118 UTSW 17 37672220 missense probably damaging 1.00
R7355:Olfr118 UTSW 17 37672410 missense probably benign 0.02
R7861:Olfr118 UTSW 17 37672517 missense possibly damaging 0.91
R7913:Olfr118 UTSW 17 37672108 missense probably benign
R7944:Olfr118 UTSW 17 37672517 missense possibly damaging 0.91
R7994:Olfr118 UTSW 17 37672108 missense probably benign
RF003:Olfr118 UTSW 17 37672858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAACACTTTGCATTTGCCAAG -3'
(R):5'- AAATGGGCACATACCTCACG -3'

Sequencing Primer
(F):5'- CCAAGTTCTCTGAGGTTCCTGAAG -3'
(R):5'- GGCACATACCTCACGACTCATTC -3'
Posted On2016-10-26