Incidental Mutation 'R5600:Mtpap'
ID439005
Institutional Source Beutler Lab
Gene Symbol Mtpap
Ensembl Gene ENSMUSG00000024234
Gene Namemitochondrial poly(A) polymerase
SynonymsPapd1, 0610027A18Rik
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4375592-4397330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4379674 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 88 (E88G)
Ref Sequence ENSEMBL: ENSMUSP00000025077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025077]
Predicted Effect probably damaging
Transcript: ENSMUST00000025077
AA Change: E88G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025077
Gene: ENSMUSG00000024234
AA Change: E88G

DomainStartEndE-ValueType
PDB:3PQ1|B 44 528 N/A PDB
SCOP:d1f5aa2 187 523 1e-35 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180970
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the DNA polymerase type-B-like family. This enzyme synthesizes the 3' poly(A) tail of mitochondrial transcripts and plays a role in replication-dependent histone mRNA degradation.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Mtpap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Mtpap APN 18 4379670 missense probably damaging 0.99
IGL00848:Mtpap APN 18 4380717 missense probably benign 0.00
IGL02659:Mtpap APN 18 4380703 nonsense probably null
IGL02828:Mtpap APN 18 4386207 missense probably damaging 0.99
IGL03006:Mtpap APN 18 4375721 missense possibly damaging 0.49
R0031:Mtpap UTSW 18 4383244 missense probably damaging 0.96
R0350:Mtpap UTSW 18 4396195 missense possibly damaging 0.91
R3787:Mtpap UTSW 18 4380670 missense probably damaging 1.00
R4381:Mtpap UTSW 18 4383223 missense probably benign 0.04
R4698:Mtpap UTSW 18 4375724 missense possibly damaging 0.59
R4717:Mtpap UTSW 18 4396394 missense possibly damaging 0.82
R4850:Mtpap UTSW 18 4387044 missense probably damaging 1.00
R4963:Mtpap UTSW 18 4375638 missense probably benign 0.05
R4982:Mtpap UTSW 18 4396332 missense probably benign 0.01
R5059:Mtpap UTSW 18 4375827 intron probably benign
R5311:Mtpap UTSW 18 4386328 missense probably damaging 1.00
R5713:Mtpap UTSW 18 4396280 missense probably benign 0.00
R6312:Mtpap UTSW 18 4396175 missense possibly damaging 0.89
R7006:Mtpap UTSW 18 4380873 missense possibly damaging 0.63
R7059:Mtpap UTSW 18 4396202 missense probably damaging 1.00
R7117:Mtpap UTSW 18 4380889 critical splice donor site probably null
R7286:Mtpap UTSW 18 4387068 missense probably benign 0.20
R7452:Mtpap UTSW 18 4379705 missense possibly damaging 0.75
X0025:Mtpap UTSW 18 4375710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGTGCAGGTAGGCTAG -3'
(R):5'- CCTCCTTAAAGAAATGAAGGAACGG -3'

Sequencing Primer
(F):5'- GTTTGGTCCCTAGAAGCCACATAG -3'
(R):5'- GGAACGGGTGCAATGCC -3'
Posted On2016-10-26