Incidental Mutation 'R5600:Spink5'
ID439007
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44018711 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 986 (T986A)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect probably damaging
Transcript: ENSMUST00000069245
AA Change: T986A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: T986A

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
R7828:Spink5 UTSW 18 44010229 missense probably benign 0.15
R7836:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7880:Spink5 UTSW 18 43986326 missense probably benign 0.40
R7919:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7963:Spink5 UTSW 18 43986326 missense probably benign 0.40
R8031:Spink5 UTSW 18 44010236 missense probably benign 0.07
Z1177:Spink5 UTSW 18 43996635 missense probably damaging 0.97
Z1177:Spink5 UTSW 18 43996697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTTCTAGCTGTATTGCTG -3'
(R):5'- GGCCAGACAAATTCTCATTTTCC -3'

Sequencing Primer
(F):5'- ATGTGTGCCAGTGCTCATAACAC -3'
(R):5'- CTCATTTTCCAGTGCAATAGAACC -3'
Posted On2016-10-26