Incidental Mutation 'R5601:Stkld1'
ID439011
Institutional Source Beutler Lab
Gene Symbol Stkld1
Ensembl Gene ENSMUSG00000049897
Gene Nameserine/threonine kinase-like domain containing 1
SynonymsLOC279029, Gm711
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26934047-26953496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26952705 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 563 (L563P)
Ref Sequence ENSEMBL: ENSMUSP00000062967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055406] [ENSMUST00000064244] [ENSMUST00000114020] [ENSMUST00000136710]
Predicted Effect probably damaging
Transcript: ENSMUST00000055406
AA Change: L563P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062967
Gene: ENSMUSG00000049897
AA Change: L563P

DomainStartEndE-ValueType
Pfam:Pkinase 3 266 8e-35 PFAM
Pfam:Pkinase_Tyr 7 262 4.5e-27 PFAM
low complexity region 352 366 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064244
SMART Domains Protein: ENSMUSP00000070815
Gene: ENSMUSG00000052406

DomainStartEndE-ValueType
low complexity region 16 34 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
EXOIII 229 390 2.55e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114020
SMART Domains Protein: ENSMUSP00000109653
Gene: ENSMUSG00000052406

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
low complexity region 203 220 N/A INTRINSIC
EXOIII 252 413 2.55e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135752
Predicted Effect probably benign
Transcript: ENSMUST00000136710
SMART Domains Protein: ENSMUSP00000121599
Gene: ENSMUSG00000052406

DomainStartEndE-ValueType
low complexity region 16 34 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
EXOIII 229 363 1.57e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145546
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Stkld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Stkld1 APN 2 26951471 missense probably benign 0.01
IGL02183:Stkld1 APN 2 26946659 missense probably benign 0.04
IGL02393:Stkld1 APN 2 26950142 missense probably benign 0.41
IGL03136:Stkld1 APN 2 26951423 missense probably benign 0.00
IGL03261:Stkld1 APN 2 26952777 missense probably benign 0.21
R0067:Stkld1 UTSW 2 26949340 missense probably benign 0.01
R0067:Stkld1 UTSW 2 26949340 missense probably benign 0.01
R0973:Stkld1 UTSW 2 26951450 missense probably benign 0.00
R1065:Stkld1 UTSW 2 26940038 missense probably damaging 0.97
R1467:Stkld1 UTSW 2 26949395 missense probably benign 0.00
R1467:Stkld1 UTSW 2 26949395 missense probably benign 0.00
R1565:Stkld1 UTSW 2 26950090 missense probably benign 0.00
R1844:Stkld1 UTSW 2 26950103 missense probably damaging 1.00
R1871:Stkld1 UTSW 2 26937973 unclassified probably benign
R1965:Stkld1 UTSW 2 26946732 unclassified probably null
R2001:Stkld1 UTSW 2 26952747 missense probably damaging 1.00
R2308:Stkld1 UTSW 2 26952714 missense probably damaging 0.98
R2566:Stkld1 UTSW 2 26950638 missense probably damaging 1.00
R3929:Stkld1 UTSW 2 26940047 critical splice donor site probably null
R4257:Stkld1 UTSW 2 26943134 missense probably benign 0.02
R4493:Stkld1 UTSW 2 26946626 missense probably benign 0.00
R4494:Stkld1 UTSW 2 26946626 missense probably benign 0.00
R4589:Stkld1 UTSW 2 26950667 missense probably damaging 1.00
R4775:Stkld1 UTSW 2 26951745 missense probably damaging 0.99
R5707:Stkld1 UTSW 2 26943987 missense probably damaging 1.00
R6259:Stkld1 UTSW 2 26949381 missense possibly damaging 0.70
R6306:Stkld1 UTSW 2 26943887 missense probably damaging 0.98
R6349:Stkld1 UTSW 2 26945860 missense probably benign 0.00
R6418:Stkld1 UTSW 2 26941081 missense possibly damaging 0.47
R6806:Stkld1 UTSW 2 26943910 missense probably benign 0.01
R7079:Stkld1 UTSW 2 26949347 missense probably benign 0.00
R7199:Stkld1 UTSW 2 26952714 missense probably damaging 0.98
R7522:Stkld1 UTSW 2 26947247 missense probably benign 0.13
R7556:Stkld1 UTSW 2 26947295 missense possibly damaging 0.74
R7813:Stkld1 UTSW 2 26945876 nonsense probably null
R8165:Stkld1 UTSW 2 26946656 missense probably benign 0.01
R8330:Stkld1 UTSW 2 26951503 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCAGTCATGCTACTTCCCG -3'
(R):5'- TGGTGAGGCTAAGGATACCC -3'

Sequencing Primer
(F):5'- TACTTCCCGGGGACACTGAG -3'
(R):5'- TTACGGTGCCACTGACTCAGAG -3'
Posted On2016-10-26